Incidental Mutation 'R1364:Prl3b1'
ID162862
Institutional Source Beutler Lab
Gene Symbol Prl3b1
Ensembl Gene ENSMUSG00000038891
Gene Nameprolactin family 3, subfamily b, member 1
SynonymsmplII, Csh2, Pl2, prolactin-like, Pl-2, PL, mPL-II
MMRRC Submission 039429-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R1364 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location27241847-27249683 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 27243865 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 53 (A53T)
Ref Sequence ENSEMBL: ENSMUSP00000047680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035273] [ENSMUST00000225089]
Predicted Effect probably benign
Transcript: ENSMUST00000035273
AA Change: A53T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000047680
Gene: ENSMUSG00000038891
AA Change: A53T

DomainStartEndE-ValueType
Pfam:Hormone_1 18 222 1e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000225089
AA Change: A53T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.1296 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.8%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,987,030 F2519S probably damaging Het
Ahi1 T A 10: 20,972,156 L488I probably damaging Het
Cobll1 A G 2: 65,126,310 probably benign Het
Csn1s1 T C 5: 87,677,584 probably benign Het
D430041D05Rik A T 2: 104,155,018 S1920T possibly damaging Het
Dnah17 T A 11: 118,125,606 probably benign Het
Fam126a T C 5: 23,965,353 T333A probably benign Het
Fanca G A 8: 123,304,281 probably benign Het
Fnbp1 T C 2: 31,059,031 probably benign Het
Herc1 T A 9: 66,400,093 L1023Q probably damaging Het
Hjurp T TN 1: 88,266,525 probably null Het
Kcnt1 A G 2: 25,908,094 M906V probably damaging Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Mid1 A C X: 169,986,094 N215H probably damaging Het
Mug1 T A 6: 121,881,713 L1130Q probably damaging Het
Nebl A T 2: 17,393,037 probably benign Het
Olfr1491 T C 19: 13,705,445 V206A probably benign Het
Otud7b A G 3: 96,151,451 D320G probably damaging Het
Piezo1 T C 8: 122,498,571 E563G possibly damaging Het
Prkd3 T C 17: 78,957,258 T643A probably damaging Het
Rasl10b G A 11: 83,417,839 probably null Het
Ripk3 A C 14: 55,785,260 probably null Het
Sgsm3 T C 15: 81,007,942 F237S probably damaging Het
Slit3 G A 11: 35,670,107 V960I probably benign Het
Sptbn2 T C 19: 4,732,665 L543P probably damaging Het
Tll2 G A 19: 41,120,228 R328C probably damaging Het
Unkl A G 17: 25,189,623 I54V probably benign Het
Wdr75 A G 1: 45,799,062 T44A probably benign Het
Other mutations in Prl3b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02385:Prl3b1 APN 13 27249383 missense possibly damaging 0.51
IGL02669:Prl3b1 APN 13 27245812 missense probably benign 0.24
IGL03035:Prl3b1 APN 13 27249533 unclassified probably benign
IGL03077:Prl3b1 APN 13 27245776 missense probably benign 0.00
gabby UTSW 13 27247945 missense probably damaging 1.00
Pits UTSW 13 27247974 critical splice donor site probably null
R0716:Prl3b1 UTSW 13 27243796 missense probably benign 0.02
R0758:Prl3b1 UTSW 13 27243865 missense probably benign 0.00
R0773:Prl3b1 UTSW 13 27243865 missense probably benign 0.00
R0774:Prl3b1 UTSW 13 27243865 missense probably benign 0.00
R0775:Prl3b1 UTSW 13 27243865 missense probably benign 0.00
R1366:Prl3b1 UTSW 13 27243865 missense probably benign 0.00
R1367:Prl3b1 UTSW 13 27243865 missense probably benign 0.00
R1368:Prl3b1 UTSW 13 27243865 missense probably benign 0.00
R1530:Prl3b1 UTSW 13 27243865 missense probably benign 0.00
R1884:Prl3b1 UTSW 13 27247903 missense possibly damaging 0.95
R1990:Prl3b1 UTSW 13 27245792 missense possibly damaging 0.94
R1991:Prl3b1 UTSW 13 27247912 missense possibly damaging 0.60
R2014:Prl3b1 UTSW 13 27247965 missense probably benign 0.00
R2885:Prl3b1 UTSW 13 27249522 missense probably damaging 1.00
R4259:Prl3b1 UTSW 13 27243906 splice site probably null
R4580:Prl3b1 UTSW 13 27249467 missense possibly damaging 0.93
R4913:Prl3b1 UTSW 13 27249477 missense probably damaging 0.99
R5897:Prl3b1 UTSW 13 27245875 missense probably benign 0.08
R6235:Prl3b1 UTSW 13 27247945 missense probably damaging 1.00
R6366:Prl3b1 UTSW 13 27243892 missense probably benign 0.00
R6597:Prl3b1 UTSW 13 27247974 critical splice donor site probably null
R7179:Prl3b1 UTSW 13 27243844 missense probably benign 0.05
R7312:Prl3b1 UTSW 13 27242490 start codon destroyed probably null 1.00
X0026:Prl3b1 UTSW 13 27247923 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- GGACAGACAGTATAGCCTCTACAGTGT -3'
(R):5'- AGGGTTTGATGATTGCTCCATTGGAA -3'

Sequencing Primer
(F):5'- CAGTATAGCCTCTACAGTGTCATTTG -3'
(R):5'- ggaggaggtgagaggtgg -3'
Posted On2014-03-17