Mutagenetix > Incidental Mutations

Incidental Mutation 'R1378:Pon3'

162939

Institutional Source

Beutler Lab

Gene Symbol

Pon3

Ensembl Gene

ENSMUSG00000029759

Gene Name

paraoxonase 3

Synonyms

MMRRC Submission

039442-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1378 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

5220852-5256286 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 5230813 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Alanine at position 238 (D238A)

Ref Sequence

ENSEMBL: ENSMUSP00000031773 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031773] [ENSMUST00000125686] [ENSMUST00000129344]

Predicted Effect

probably benign
Transcript: ENSMUST00000031773
AA Change: D238A

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000031773
Gene: ENSMUSG00000029759
AA Change: D238A

Domain	Start	End	E-Value	Type
Pfam:SGL	84	304	8.8e-9	PFAM
Pfam:Arylesterase	167	252	2.5e-43	PFAM
Pfam:Str_synth	184	250	3e-8	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000125686

SMART Domains

Protein: ENSMUSP00000135603
Gene: ENSMUSG00000029759

Domain	Start	End	E-Value	Type
Pfam:Arylesterase	94	135	9.1e-20	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000129344

SMART Domains

Protein: ENSMUSP00000118137
Gene: ENSMUSG00000029759

Domain	Start	End	E-Value	Type
PDB:4HHQ\|A	1	67	3e-17	PDB

Meta Mutation Damage Score

0.064

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.3%
20x: 89.3%

Validation Efficiency

100% (57/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the paraoxonase family and lies in a cluster on chromosome 7 with the other two family members. The encoded protein is secreted into the bloodstream and associates with high-density lipoprotein (HDL). The protein also rapidly hydrolyzes lactones and can inhibit the oxidation of low-density lipoprotein (LDL), a function that is believed to slow the initiation and progression of atherosclerosis. Alternatively spliced variants which encode different protein isoforms have been described; however, only one has been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show prenatal and postnatal lethality. Homozygotes for a different null allele are viable but show altered lipid and bile acid metabolism, impaired mitochondrial respiration, and increased susceptibility to diet-induced atherosclerosis, gallstone formation, and obesity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9030624J02Rik	G	T	7: 118,794,572	E515*	probably null	Het
9030624J02Rik	A	T	7: 118,794,573	E515V	probably damaging	Het
Afap1	A	G	5: 35,968,686	T342A	probably damaging	Het
Alg1	A	G	16: 5,243,716	N406D	probably damaging	Het
Atp13a4	A	T	16: 29,420,428	M825K	probably damaging	Het
BC100530	A	G	16: 36,359,567	C63R	probably benign	Het
Birc6	T	A	17: 74,660,455	I4117K	probably damaging	Het
Brinp2	A	T	1: 158,247,054	L499Q	possibly damaging	Het
Brwd1	A	T	16: 96,041,370	V789D	probably benign	Het
Ccdc153	C	G	9: 44,243,661	L94V	probably null	Het
Ccna1	A	G	3: 55,049,729	V237A	probably damaging	Het
Cct7	T	A	6: 85,467,563		probably null	Het
Cenpb	C	T	2: 131,178,310		probably benign	Het
Chrne	T	A	11: 70,615,130		probably null	Het
Clstn3	T	A	6: 124,438,419	D662V	probably damaging	Het
Clu	G	T	14: 65,974,901	C189F	probably damaging	Het
Cul7	C	T	17: 46,662,126	R1388C	probably damaging	Het
Dgka	T	C	10: 128,735,827		probably null	Het
Dopey2	A	G	16: 93,770,392	T1236A	probably benign	Het
Edn2	A	G	4: 120,161,898	E28G	probably benign	Het
Elp3	T	C	14: 65,592,931	I24V	probably benign	Het
Faap24	T	C	7: 35,392,901	E197G	probably benign	Het
Fam13a	T	A	6: 58,956,751	M285L	probably benign	Het
Gm1966	T	A	7: 106,602,166	I624F	probably damaging	Het
Gm9944	T	A	4: 144,453,203		probably benign	Het
Gsdmc3	T	C	15: 63,859,586		probably benign	Het
Ift22	A	C	5: 136,912,903	K133T	probably benign	Het
Il23r	T	A	6: 67,452,410	K316I	possibly damaging	Het
Klra17	T	A	6: 129,865,684	E217V	probably damaging	Het
Nell2	A	T	15: 95,232,521	V657E	probably damaging	Het
Nlrp4d	C	A	7: 10,364,184	K850N	probably benign	Het
Nsmce4a	C	T	7: 130,538,170	R276Q	probably benign	Het
Olfr1208	T	A	2: 88,897,026	R190S	probably benign	Het
Olfr591	T	C	7: 103,173,268	D123G	probably damaging	Het
Olfr619	A	T	7: 103,603,938	R95*	probably null	Het
Olfr963	T	C	9: 39,669,666	L203P	probably damaging	Het
Pclo	T	C	5: 14,682,313	S3610P	probably benign	Het
Ppp4r4	T	C	12: 103,581,492		probably benign	Het
Rad18	T	C	6: 112,681,336		probably benign	Het
Ralgapa1	T	C	12: 55,676,926	Y1652C	probably damaging	Het
Rem1	G	A	2: 152,634,535	V238M	probably damaging	Het
Sel1l	T	C	12: 91,833,097		probably null	Het
Soat1	A	G	1: 156,466,782		probably benign	Het
Tex15	A	T	8: 33,575,216	N1558I	probably damaging	Het
Tmem132d	A	T	5: 128,268,947	F170L	probably benign	Het
Tro	G	T	X: 150,655,571	P30Q	probably damaging	Het
Tubg2	G	T	11: 101,156,873	E95*	probably null	Het
Unc45b	G	A	11: 82,936,852	S725N	probably benign	Het
Vmn2r7	A	G	3: 64,691,604	S511P	possibly damaging	Het
Zfp174	G	A	16: 3,849,489	E181K	probably benign	Het

Other mutations in Pon3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01977:Pon3	APN	6	5221670	missense	probably damaging	1.00
IGL01983:Pon3	APN	6	5240974	missense	probably damaging	1.00
IGL02601:Pon3	APN	6	5221671	missense	probably damaging	1.00
IGL02661:Pon3	APN	6	5256205	missense	probably benign	0.05
IGL03168:Pon3	APN	6	5256177	missense	possibly damaging	0.54
IGL02988:Pon3	UTSW	6	5232330	missense	possibly damaging	0.91
R0242:Pon3	UTSW	6	5240860	missense	probably benign	0.25
R0242:Pon3	UTSW	6	5240860	missense	probably benign	0.25
R0566:Pon3	UTSW	6	5232408	missense	possibly damaging	0.89
R0730:Pon3	UTSW	6	5230444	missense	probably benign	0.18
R1955:Pon3	UTSW	6	5230774	missense	probably benign	0.02
R2697:Pon3	UTSW	6	5232429	missense	possibly damaging	0.67
R2975:Pon3	UTSW	6	5232345	missense	probably damaging	1.00
R3794:Pon3	UTSW	6	5221578	missense	probably benign	0.22
R4940:Pon3	UTSW	6	5221625	missense	possibly damaging	0.75
R4988:Pon3	UTSW	6	5254582	nonsense	probably null
R4990:Pon3	UTSW	6	5221619	missense	probably benign
R5266:Pon3	UTSW	6	5240860	missense	possibly damaging	0.66
R5473:Pon3	UTSW	6	5256177	missense	possibly damaging	0.54
R6152:Pon3	UTSW	6	5221716	missense	probably damaging	1.00
R6746:Pon3	UTSW	6	5230786	missense	possibly damaging	0.54

Predicted Primers

PCR Primer
(F):5'- TCCAGCACTGGGCACTAGCATTTC -3'
(R):5'- TGTGATTGAGCTTCGTTGCCACC -3'

Sequencing Primer
(F):5'- GCTTGGTGATAGCCCTCTAAAAG -3'
(R):5'- GACTCTATCATTGGAAGGATGCTC -3'

Posted On

2014-03-17