Incidental Mutation 'R1378:Pon3'
ID162939
Institutional Source Beutler Lab
Gene Symbol Pon3
Ensembl Gene ENSMUSG00000029759
Gene Nameparaoxonase 3
Synonyms
MMRRC Submission 039442-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1378 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location5220852-5256286 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 5230813 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 238 (D238A)
Ref Sequence ENSEMBL: ENSMUSP00000031773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031773] [ENSMUST00000125686] [ENSMUST00000129344]
Predicted Effect probably benign
Transcript: ENSMUST00000031773
AA Change: D238A

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000031773
Gene: ENSMUSG00000029759
AA Change: D238A

DomainStartEndE-ValueType
Pfam:SGL 84 304 8.8e-9 PFAM
Pfam:Arylesterase 167 252 2.5e-43 PFAM
Pfam:Str_synth 184 250 3e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125686
SMART Domains Protein: ENSMUSP00000135603
Gene: ENSMUSG00000029759

DomainStartEndE-ValueType
Pfam:Arylesterase 94 135 9.1e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129344
SMART Domains Protein: ENSMUSP00000118137
Gene: ENSMUSG00000029759

DomainStartEndE-ValueType
PDB:4HHQ|A 1 67 3e-17 PDB
Meta Mutation Damage Score 0.064 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.3%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the paraoxonase family and lies in a cluster on chromosome 7 with the other two family members. The encoded protein is secreted into the bloodstream and associates with high-density lipoprotein (HDL). The protein also rapidly hydrolyzes lactones and can inhibit the oxidation of low-density lipoprotein (LDL), a function that is believed to slow the initiation and progression of atherosclerosis. Alternatively spliced variants which encode different protein isoforms have been described; however, only one has been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show prenatal and postnatal lethality. Homozygotes for a different null allele are viable but show altered lipid and bile acid metabolism, impaired mitochondrial respiration, and increased susceptibility to diet-induced atherosclerosis, gallstone formation, and obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik G T 7: 118,794,572 E515* probably null Het
9030624J02Rik A T 7: 118,794,573 E515V probably damaging Het
Afap1 A G 5: 35,968,686 T342A probably damaging Het
Alg1 A G 16: 5,243,716 N406D probably damaging Het
Atp13a4 A T 16: 29,420,428 M825K probably damaging Het
BC100530 A G 16: 36,359,567 C63R probably benign Het
Birc6 T A 17: 74,660,455 I4117K probably damaging Het
Brinp2 A T 1: 158,247,054 L499Q possibly damaging Het
Brwd1 A T 16: 96,041,370 V789D probably benign Het
Ccdc153 C G 9: 44,243,661 L94V probably null Het
Ccna1 A G 3: 55,049,729 V237A probably damaging Het
Cct7 T A 6: 85,467,563 probably null Het
Cenpb C T 2: 131,178,310 probably benign Het
Chrne T A 11: 70,615,130 probably null Het
Clstn3 T A 6: 124,438,419 D662V probably damaging Het
Clu G T 14: 65,974,901 C189F probably damaging Het
Cul7 C T 17: 46,662,126 R1388C probably damaging Het
Dgka T C 10: 128,735,827 probably null Het
Dopey2 A G 16: 93,770,392 T1236A probably benign Het
Edn2 A G 4: 120,161,898 E28G probably benign Het
Elp3 T C 14: 65,592,931 I24V probably benign Het
Faap24 T C 7: 35,392,901 E197G probably benign Het
Fam13a T A 6: 58,956,751 M285L probably benign Het
Gm1966 T A 7: 106,602,166 I624F probably damaging Het
Gm9944 T A 4: 144,453,203 probably benign Het
Gsdmc3 T C 15: 63,859,586 probably benign Het
Ift22 A C 5: 136,912,903 K133T probably benign Het
Il23r T A 6: 67,452,410 K316I possibly damaging Het
Klra17 T A 6: 129,865,684 E217V probably damaging Het
Nell2 A T 15: 95,232,521 V657E probably damaging Het
Nlrp4d C A 7: 10,364,184 K850N probably benign Het
Nsmce4a C T 7: 130,538,170 R276Q probably benign Het
Olfr1208 T A 2: 88,897,026 R190S probably benign Het
Olfr591 T C 7: 103,173,268 D123G probably damaging Het
Olfr619 A T 7: 103,603,938 R95* probably null Het
Olfr963 T C 9: 39,669,666 L203P probably damaging Het
Pclo T C 5: 14,682,313 S3610P probably benign Het
Ppp4r4 T C 12: 103,581,492 probably benign Het
Rad18 T C 6: 112,681,336 probably benign Het
Ralgapa1 T C 12: 55,676,926 Y1652C probably damaging Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Sel1l T C 12: 91,833,097 probably null Het
Soat1 A G 1: 156,466,782 probably benign Het
Tex15 A T 8: 33,575,216 N1558I probably damaging Het
Tmem132d A T 5: 128,268,947 F170L probably benign Het
Tro G T X: 150,655,571 P30Q probably damaging Het
Tubg2 G T 11: 101,156,873 E95* probably null Het
Unc45b G A 11: 82,936,852 S725N probably benign Het
Vmn2r7 A G 3: 64,691,604 S511P possibly damaging Het
Zfp174 G A 16: 3,849,489 E181K probably benign Het
Other mutations in Pon3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01977:Pon3 APN 6 5221670 missense probably damaging 1.00
IGL01983:Pon3 APN 6 5240974 missense probably damaging 1.00
IGL02601:Pon3 APN 6 5221671 missense probably damaging 1.00
IGL02661:Pon3 APN 6 5256205 missense probably benign 0.05
IGL03168:Pon3 APN 6 5256177 missense possibly damaging 0.54
IGL02988:Pon3 UTSW 6 5232330 missense possibly damaging 0.91
R0242:Pon3 UTSW 6 5240860 missense probably benign 0.25
R0242:Pon3 UTSW 6 5240860 missense probably benign 0.25
R0566:Pon3 UTSW 6 5232408 missense possibly damaging 0.89
R0730:Pon3 UTSW 6 5230444 missense probably benign 0.18
R1955:Pon3 UTSW 6 5230774 missense probably benign 0.02
R2697:Pon3 UTSW 6 5232429 missense possibly damaging 0.67
R2975:Pon3 UTSW 6 5232345 missense probably damaging 1.00
R3794:Pon3 UTSW 6 5221578 missense probably benign 0.22
R4940:Pon3 UTSW 6 5221625 missense possibly damaging 0.75
R4988:Pon3 UTSW 6 5254582 nonsense probably null
R4990:Pon3 UTSW 6 5221619 missense probably benign
R5266:Pon3 UTSW 6 5240860 missense possibly damaging 0.66
R5473:Pon3 UTSW 6 5256177 missense possibly damaging 0.54
R6152:Pon3 UTSW 6 5221716 missense probably damaging 1.00
R6746:Pon3 UTSW 6 5230786 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- TCCAGCACTGGGCACTAGCATTTC -3'
(R):5'- TGTGATTGAGCTTCGTTGCCACC -3'

Sequencing Primer
(F):5'- GCTTGGTGATAGCCCTCTAAAAG -3'
(R):5'- GACTCTATCATTGGAAGGATGCTC -3'
Posted On2014-03-17