Incidental Mutation 'R1378:Il23r'
ID162941
Institutional Source Beutler Lab
Gene Symbol Il23r
Ensembl Gene ENSMUSG00000049093
Gene Nameinterleukin 23 receptor
Synonyms
MMRRC Submission 039442-MU
Accession Numbers

Ncbi RefSeq: NM_144548.1; MGI:2181693

Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R1378 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location67422932-67491855 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 67452410 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Isoleucine at position 316 (K316I)
Ref Sequence ENSEMBL: ENSMUSP00000113342 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118364]
Predicted Effect possibly damaging
Transcript: ENSMUST00000118364
AA Change: K316I

PolyPhen 2 Score 0.684 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000113342
Gene: ENSMUSG00000049093
AA Change: K316I

DomainStartEndE-ValueType
FN3 140 220 1e-1 SMART
Blast:FN3 235 317 2e-38 BLAST
transmembrane domain 388 410 N/A INTRINSIC
Meta Mutation Damage Score 0.0624 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.3%
Validation Efficiency 100% (57/57)
MGI Phenotype Strain: 4355925
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the receptor for IL23A/IL23. This protein pairs with the receptor molecule IL12RB1/IL12Rbeta1, and both are required for IL23A signaling. This protein associates constitutively with Janus kinase 2 (JAK2), and also binds to transcription activator STAT3 in a ligand-dependent manner. [provided by RefSeq, Jul 2008]
PHENOTYPE: Th17 T cells from homozygous null mice have less secretion of IL-9 upon secondary stimulation. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted(6)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik G T 7: 118,794,572 E515* probably null Het
9030624J02Rik A T 7: 118,794,573 E515V probably damaging Het
Afap1 A G 5: 35,968,686 T342A probably damaging Het
Alg1 A G 16: 5,243,716 N406D probably damaging Het
Atp13a4 A T 16: 29,420,428 M825K probably damaging Het
BC100530 A G 16: 36,359,567 C63R probably benign Het
Birc6 T A 17: 74,660,455 I4117K probably damaging Het
Brinp2 A T 1: 158,247,054 L499Q possibly damaging Het
Brwd1 A T 16: 96,041,370 V789D probably benign Het
Ccdc153 C G 9: 44,243,661 L94V probably null Het
Ccna1 A G 3: 55,049,729 V237A probably damaging Het
Cct7 T A 6: 85,467,563 probably null Het
Cenpb C T 2: 131,178,310 probably benign Het
Chrne T A 11: 70,615,130 probably null Het
Clstn3 T A 6: 124,438,419 D662V probably damaging Het
Clu G T 14: 65,974,901 C189F probably damaging Het
Cul7 C T 17: 46,662,126 R1388C probably damaging Het
Dgka T C 10: 128,735,827 probably null Het
Dopey2 A G 16: 93,770,392 T1236A probably benign Het
Edn2 A G 4: 120,161,898 E28G probably benign Het
Elp3 T C 14: 65,592,931 I24V probably benign Het
Faap24 T C 7: 35,392,901 E197G probably benign Het
Fam13a T A 6: 58,956,751 M285L probably benign Het
Gm1966 T A 7: 106,602,166 I624F probably damaging Het
Gm9944 T A 4: 144,453,203 probably benign Het
Gsdmc3 T C 15: 63,859,586 probably benign Het
Ift22 A C 5: 136,912,903 K133T probably benign Het
Klra17 T A 6: 129,865,684 E217V probably damaging Het
Nell2 A T 15: 95,232,521 V657E probably damaging Het
Nlrp4d C A 7: 10,364,184 K850N probably benign Het
Nsmce4a C T 7: 130,538,170 R276Q probably benign Het
Olfr1208 T A 2: 88,897,026 R190S probably benign Het
Olfr591 T C 7: 103,173,268 D123G probably damaging Het
Olfr619 A T 7: 103,603,938 R95* probably null Het
Olfr963 T C 9: 39,669,666 L203P probably damaging Het
Pclo T C 5: 14,682,313 S3610P probably benign Het
Pon3 T G 6: 5,230,813 D238A probably benign Het
Ppp4r4 T C 12: 103,581,492 probably benign Het
Rad18 T C 6: 112,681,336 probably benign Het
Ralgapa1 T C 12: 55,676,926 Y1652C probably damaging Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Sel1l T C 12: 91,833,097 probably null Het
Soat1 A G 1: 156,466,782 probably benign Het
Tex15 A T 8: 33,575,216 N1558I probably damaging Het
Tmem132d A T 5: 128,268,947 F170L probably benign Het
Tro G T X: 150,655,571 P30Q probably damaging Het
Tubg2 G T 11: 101,156,873 E95* probably null Het
Unc45b G A 11: 82,936,852 S725N probably benign Het
Vmn2r7 A G 3: 64,691,604 S511P possibly damaging Het
Zfp174 G A 16: 3,849,489 E181K probably benign Het
Other mutations in Il23r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00668:Il23r APN 6 67423628 missense probably damaging 0.96
IGL00886:Il23r APN 6 67473890 missense possibly damaging 0.94
IGL00916:Il23r APN 6 67473931 missense probably damaging 1.00
IGL01102:Il23r APN 6 67423925 missense probably damaging 0.98
IGL01466:Il23r APN 6 67426642 missense probably benign 0.30
IGL01627:Il23r APN 6 67423428 missense probably benign 0.17
IGL02160:Il23r APN 6 67423578 missense probably benign 0.09
IGL02394:Il23r APN 6 67466272 splice site probably benign
IGL02418:Il23r APN 6 67490672 missense possibly damaging 0.46
IGL02818:Il23r APN 6 67486094 critical splice donor site probably null
IGL03230:Il23r APN 6 67423964 missense probably benign 0.31
R0029:Il23r UTSW 6 67478945 critical splice donor site probably null
R0029:Il23r UTSW 6 67478945 critical splice donor site probably null
R0035:Il23r UTSW 6 67473788 splice site probably benign
R0035:Il23r UTSW 6 67473788 splice site probably benign
R0085:Il23r UTSW 6 67486222 missense probably damaging 1.00
R0477:Il23r UTSW 6 67452377 missense probably benign 0.00
R0534:Il23r UTSW 6 67426588 missense probably benign 0.00
R0547:Il23r UTSW 6 67423701 missense probably benign 0.05
R0547:Il23r UTSW 6 67486251 missense possibly damaging 0.57
R0666:Il23r UTSW 6 67434680 missense probably benign 0.08
R0702:Il23r UTSW 6 67466285 missense probably damaging 0.97
R0715:Il23r UTSW 6 67486333 missense possibly damaging 0.63
R1077:Il23r UTSW 6 67473810 missense probably benign 0.40
R1202:Il23r UTSW 6 67478953 missense possibly damaging 0.95
R1328:Il23r UTSW 6 67491818 start gained probably benign
R1420:Il23r UTSW 6 67486197 missense probably damaging 1.00
R1475:Il23r UTSW 6 67452296 critical splice donor site probably null
R1628:Il23r UTSW 6 67423609 missense probably damaging 1.00
R1745:Il23r UTSW 6 67466291 missense probably damaging 0.98
R1887:Il23r UTSW 6 67473801 missense possibly damaging 0.88
R1901:Il23r UTSW 6 67423734 missense probably benign 0.44
R1902:Il23r UTSW 6 67423734 missense probably benign 0.44
R1928:Il23r UTSW 6 67423735 missense possibly damaging 0.79
R1984:Il23r UTSW 6 67490668 splice site probably null
R1985:Il23r UTSW 6 67490668 splice site probably null
R2264:Il23r UTSW 6 67426667 critical splice acceptor site probably null
R2290:Il23r UTSW 6 67423861 missense probably benign 0.17
R2363:Il23r UTSW 6 67452417 missense probably benign 0.08
R3430:Il23r UTSW 6 67452474 missense probably benign 0.08
R3964:Il23r UTSW 6 67466297 missense probably benign 0.13
R4073:Il23r UTSW 6 67486122 missense probably damaging 1.00
R4164:Il23r UTSW 6 67423663 missense probably benign 0.00
R4643:Il23r UTSW 6 67423993 missense probably benign 0.08
R4700:Il23r UTSW 6 67473850 missense probably damaging 1.00
R4703:Il23r UTSW 6 67490702 missense probably damaging 1.00
R4720:Il23r UTSW 6 67423661 missense probably damaging 1.00
R4828:Il23r UTSW 6 67431651 missense probably benign 0.31
R4911:Il23r UTSW 6 67423561 missense probably benign 0.17
R5119:Il23r UTSW 6 67466316 missense probably damaging 1.00
R5152:Il23r UTSW 6 67423741 missense probably damaging 0.98
R5223:Il23r UTSW 6 67486170 missense probably benign 0.23
R5271:Il23r UTSW 6 67423696 missense probably benign 0.16
R5330:Il23r UTSW 6 67423495 missense probably damaging 1.00
R5331:Il23r UTSW 6 67423495 missense probably damaging 1.00
R5384:Il23r UTSW 6 67486291 missense probably benign 0.10
R5874:Il23r UTSW 6 67431645 missense possibly damaging 0.92
R6037:Il23r UTSW 6 67478954 missense probably damaging 0.99
R6037:Il23r UTSW 6 67478954 missense probably damaging 0.99
R6377:Il23r UTSW 6 67423652 missense probably damaging 0.99
R6925:Il23r UTSW 6 67423493 missense probably damaging 1.00
R6975:Il23r UTSW 6 67423368 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCCAATGGTGTGTGGAATCAAG -3'
(R):5'- TGCCCAGACTCTAATAGGTGTCCC -3'

Sequencing Primer
(F):5'- CTTCTCTCAATGATAGCAGGCAAG -3'
(R):5'- CAGACTCTAATAGGTGTCCCATAGG -3'
Posted On2014-03-17