Incidental Mutation 'R1378:Gsdmc3'
ID162966
Institutional Source Beutler Lab
Gene Symbol Gsdmc3
Ensembl Gene ENSMUSG00000055827
Gene Namegasdermin C3
Synonyms9930109F21Rik
MMRRC Submission 039442-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.049) question?
Stock #R1378 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location63857724-63878558 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 63859586 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139472 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089894] [ENSMUST00000185526] [ENSMUST00000190682]
Predicted Effect probably benign
Transcript: ENSMUST00000089894
SMART Domains Protein: ENSMUSP00000087339
Gene: ENSMUSG00000055827

DomainStartEndE-ValueType
Pfam:Gasdermin 4 443 2.1e-154 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185526
SMART Domains Protein: ENSMUSP00000140272
Gene: ENSMUSG00000055827

DomainStartEndE-ValueType
Pfam:Gasdermin 4 443 1.4e-145 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190682
SMART Domains Protein: ENSMUSP00000139472
Gene: ENSMUSG00000055827

DomainStartEndE-ValueType
Pfam:Gasdermin 4 443 1.4e-145 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190937
Meta Mutation Damage Score 0.05 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.3%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik G T 7: 118,794,572 E515* probably null Het
9030624J02Rik A T 7: 118,794,573 E515V probably damaging Het
Afap1 A G 5: 35,968,686 T342A probably damaging Het
Alg1 A G 16: 5,243,716 N406D probably damaging Het
Atp13a4 A T 16: 29,420,428 M825K probably damaging Het
BC100530 A G 16: 36,359,567 C63R probably benign Het
Birc6 T A 17: 74,660,455 I4117K probably damaging Het
Brinp2 A T 1: 158,247,054 L499Q possibly damaging Het
Brwd1 A T 16: 96,041,370 V789D probably benign Het
Ccdc153 C G 9: 44,243,661 L94V probably null Het
Ccna1 A G 3: 55,049,729 V237A probably damaging Het
Cct7 T A 6: 85,467,563 probably null Het
Cenpb C T 2: 131,178,310 probably benign Het
Chrne T A 11: 70,615,130 probably null Het
Clstn3 T A 6: 124,438,419 D662V probably damaging Het
Clu G T 14: 65,974,901 C189F probably damaging Het
Cul7 C T 17: 46,662,126 R1388C probably damaging Het
Dgka T C 10: 128,735,827 probably null Het
Dopey2 A G 16: 93,770,392 T1236A probably benign Het
Edn2 A G 4: 120,161,898 E28G probably benign Het
Elp3 T C 14: 65,592,931 I24V probably benign Het
Faap24 T C 7: 35,392,901 E197G probably benign Het
Fam13a T A 6: 58,956,751 M285L probably benign Het
Gm1966 T A 7: 106,602,166 I624F probably damaging Het
Gm9944 T A 4: 144,453,203 probably benign Het
Ift22 A C 5: 136,912,903 K133T probably benign Het
Il23r T A 6: 67,452,410 K316I possibly damaging Het
Klra17 T A 6: 129,865,684 E217V probably damaging Het
Nell2 A T 15: 95,232,521 V657E probably damaging Het
Nlrp4d C A 7: 10,364,184 K850N probably benign Het
Nsmce4a C T 7: 130,538,170 R276Q probably benign Het
Olfr1208 T A 2: 88,897,026 R190S probably benign Het
Olfr591 T C 7: 103,173,268 D123G probably damaging Het
Olfr619 A T 7: 103,603,938 R95* probably null Het
Olfr963 T C 9: 39,669,666 L203P probably damaging Het
Pclo T C 5: 14,682,313 S3610P probably benign Het
Pon3 T G 6: 5,230,813 D238A probably benign Het
Ppp4r4 T C 12: 103,581,492 probably benign Het
Rad18 T C 6: 112,681,336 probably benign Het
Ralgapa1 T C 12: 55,676,926 Y1652C probably damaging Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Sel1l T C 12: 91,833,097 probably null Het
Soat1 A G 1: 156,466,782 probably benign Het
Tex15 A T 8: 33,575,216 N1558I probably damaging Het
Tmem132d A T 5: 128,268,947 F170L probably benign Het
Tro G T X: 150,655,571 P30Q probably damaging Het
Tubg2 G T 11: 101,156,873 E95* probably null Het
Unc45b G A 11: 82,936,852 S725N probably benign Het
Vmn2r7 A G 3: 64,691,604 S511P possibly damaging Het
Zfp174 G A 16: 3,849,489 E181K probably benign Het
Other mutations in Gsdmc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Gsdmc3 APN 15 63859677 missense probably benign 0.05
IGL01125:Gsdmc3 APN 15 63861457 missense probably benign 0.09
R0490:Gsdmc3 UTSW 15 63860250 missense possibly damaging 0.88
R0620:Gsdmc3 UTSW 15 63859693 missense probably damaging 1.00
R0932:Gsdmc3 UTSW 15 63858551 critical splice acceptor site probably null
R1298:Gsdmc3 UTSW 15 63860281 missense probably damaging 0.99
R1815:Gsdmc3 UTSW 15 63869116 missense probably damaging 1.00
R1962:Gsdmc3 UTSW 15 63858466 missense probably damaging 1.00
R1965:Gsdmc3 UTSW 15 63858447 missense probably damaging 1.00
R2088:Gsdmc3 UTSW 15 63860214 critical splice donor site probably null
R2090:Gsdmc3 UTSW 15 63866782 missense probably benign 0.07
R2126:Gsdmc3 UTSW 15 63858534 nonsense probably null
R2276:Gsdmc3 UTSW 15 63860256 missense probably benign 0.09
R4412:Gsdmc3 UTSW 15 63866796 missense probably benign 0.18
R4913:Gsdmc3 UTSW 15 63858273 makesense probably null
R5241:Gsdmc3 UTSW 15 63864146 missense possibly damaging 0.96
R6016:Gsdmc3 UTSW 15 63868412 missense probably benign 0.07
R6026:Gsdmc3 UTSW 15 63866751 missense probably damaging 1.00
R6291:Gsdmc3 UTSW 15 63860241 missense probably benign 0.00
R6698:Gsdmc3 UTSW 15 63860271 missense possibly damaging 0.94
R7316:Gsdmc3 UTSW 15 63858402 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- CCATGCACTGTTATCACTCTGAGCC -3'
(R):5'- TGGGGATTTCAGCTCCATGCAC -3'

Sequencing Primer
(F):5'- ATCACTCTGAGCCTTGCTGG -3'
(R):5'- gcaacagcctgagaccc -3'
Posted On2014-03-17