Incidental Mutation 'R1381:Ptpro'
ID163017
Institutional Source Beutler Lab
Gene Symbol Ptpro
Ensembl Gene ENSMUSG00000030223
Gene Nameprotein tyrosine phosphatase, receptor type, O
SynonymsPtpn15, PTP-oc, GLEPP1, PTP-U2, PTP-BK, PTP-phi, D28, PTPROt
MMRRC Submission 039443-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1381 (G1)
Quality Score211
Status Not validated
Chromosome6
Chromosomal Location137252319-137463233 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 137443594 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 1007 (V1007D)
Ref Sequence ENSEMBL: ENSMUSP00000127112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077115] [ENSMUST00000167002] [ENSMUST00000167679] [ENSMUST00000203914]
Predicted Effect probably damaging
Transcript: ENSMUST00000077115
AA Change: V1035D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076364
Gene: ENSMUSG00000030223
AA Change: V1035D

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 269 291 N/A INTRINSIC
FN3 443 528 1.07e-1 SMART
FN3 540 626 7.07e-2 SMART
FN3 642 722 4.47e1 SMART
FN3 733 812 5.92e-4 SMART
transmembrane domain 831 853 N/A INTRINSIC
transmembrane domain 890 912 N/A INTRINSIC
PTPc 947 1207 1.43e-127 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167002
AA Change: V214D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131764
Gene: ENSMUSG00000030223
AA Change: V214D

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
PTPc 126 386 1.43e-127 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167679
AA Change: V1007D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127112
Gene: ENSMUSG00000030223
AA Change: V1007D

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 269 291 N/A INTRINSIC
FN3 443 528 1.07e-1 SMART
FN3 540 626 7.07e-2 SMART
FN3 642 722 4.47e1 SMART
FN3 733 812 5.92e-4 SMART
transmembrane domain 831 853 N/A INTRINSIC
PTPc 919 1179 1.43e-127 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000203914
AA Change: V186D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000144870
Gene: ENSMUSG00000030223
AA Change: V186D

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
PTPc 98 358 6.1e-130 SMART
Meta Mutation Damage Score 0.624 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.4%
  • 20x: 86.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the R3 subtype family of receptor-type protein tyrosine phosphatases. These proteins are localized to the apical surface of polarized cells and may have tissue-specific functions through activation of Src family kinases. This gene contains two distinct promoters, and alternatively spliced transcript variants encoding multiple isoforms have been observed. The encoded proteins may have multiple isoform-specific and tissue-specific functions, including the regulation of osteoclast production and activity, inhibition of cell proliferation and facilitation of apoptosis. This gene is a candidate tumor suppressor, and decreased expression of this gene has been observed in several types of cancer. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for one allele display impaired glomerular filtration due to podocyte structural anomalies and a predisposition for hypertension. Mice homozygous for a second allele exhibit susceptibility to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik C A 2: 68,731,086 F252L probably benign Het
Aadac A T 3: 60,039,930 M350L probably damaging Het
Agtrap G A 4: 148,083,965 T19I probably damaging Het
Apba3 C T 10: 81,271,756 T142M possibly damaging Het
Cd55b T A 1: 130,419,675 K133I probably damaging Het
Cep295 A C 9: 15,322,565 C2312G probably benign Het
Ces1a A G 8: 93,034,031 V231A probably damaging Het
Chdh C A 14: 30,036,834 L579I probably damaging Het
Cyb5r4 T A 9: 87,022,233 S19T probably benign Het
Cyp2d22 C A 15: 82,372,508 R355L probably benign Het
Dach2 T C X: 113,298,775 Y117H probably damaging Het
Dennd4c G A 4: 86,774,532 R93K probably benign Het
Dph2 G T 4: 117,889,668 L452I probably damaging Het
Exoc6b T C 6: 84,835,117 D634G probably benign Het
Fam217b G A 2: 178,420,425 V61I probably benign Het
Fbln7 A C 2: 128,877,379 Q32P probably damaging Het
Fgfr1op2 A G 6: 146,588,741 Y46C probably damaging Het
Fhod3 T A 18: 25,090,471 I958N probably damaging Het
Foxp2 T A 6: 15,409,766 M455K possibly damaging Het
Gabrr2 G A 4: 33,081,420 G152D probably damaging Het
Galntl6 G T 8: 58,472,955 P92Q probably damaging Het
Gm5592 A T 7: 41,286,172 T33S probably benign Het
Grid2ip A T 5: 143,362,651 T166S probably benign Het
Grsf1 G A 5: 88,665,864 S225L probably benign Het
Hadha G T 5: 30,128,836 T395K probably benign Het
Hars2 C T 18: 36,789,217 A295V possibly damaging Het
Hsf5 T A 11: 87,638,169 S577T probably benign Het
Ice2 A G 9: 69,400,527 Y31C probably damaging Het
Ift80 A T 3: 68,914,783 I643N possibly damaging Het
Iglon5 A T 7: 43,476,640 D222E probably benign Het
Ilvbl C A 10: 78,576,596 S50R probably damaging Het
Invs C A 4: 48,421,942 S858* probably null Het
Ipo13 T G 4: 117,904,395 T508P probably damaging Het
Itgb4 T C 11: 115,994,337 I1015T probably benign Het
Kank4 A T 4: 98,779,938 W91R probably damaging Het
Kansl1l C T 1: 66,720,904 A906T probably benign Het
Klk4 G A 7: 43,885,282 V222M probably damaging Het
Lipo4 T A 19: 33,499,341 M336L probably benign Het
Lrig1 T C 6: 94,606,130 N1002D probably benign Het
Lzts3 A G 2: 130,635,299 S524P probably damaging Het
Maz A T 7: 127,023,152 C409* probably null Het
Mmp24 A T 2: 155,814,127 Q495L possibly damaging Het
Mrgpra9 C T 7: 47,235,302 V206I possibly damaging Het
Myof A G 19: 37,995,485 Y124H probably damaging Het
Nalcn A T 14: 123,314,105 V1030D probably damaging Het
Neb T A 2: 52,260,532 I2495F probably damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Nrbf2 G A 10: 67,267,826 T166M probably damaging Het
Nup153 T C 13: 46,689,181 D837G probably damaging Het
Nup210 C A 6: 91,075,960 G331V probably damaging Het
Olfr1143 T C 2: 87,803,136 L245P probably damaging Het
Olfr1447 T C 19: 12,900,956 T275A probably benign Het
Olfr5 A G 7: 6,481,009 probably null Het
Olfr923 T A 9: 38,828,338 S210T probably benign Het
Pabpc4 T A 4: 123,289,059 L163H probably damaging Het
Papd5 T A 8: 88,243,309 M203K possibly damaging Het
Pcdh7 T A 5: 57,721,540 Y126* probably null Het
Pdzd2 A G 15: 12,385,439 S1082P probably benign Het
Pkd2l1 T C 19: 44,150,463 I649M probably benign Het
Plcl2 G A 17: 50,607,729 E589K probably damaging Het
Plppr1 C A 4: 49,337,674 T325N possibly damaging Het
Pqlc1 T G 18: 80,283,314 S126A probably benign Het
Prss8 GCTGCCCAAGTCCC GC 7: 127,929,849 probably benign Het
Ptcd2 A G 13: 99,344,597 S25P probably benign Het
Rusc2 T A 4: 43,416,137 V481E probably damaging Het
Sephs2 G T 7: 127,272,967 T318K probably damaging Het
Sf3b1 T A 1: 55,003,154 I497L probably damaging Het
Slc30a7 C T 3: 115,956,870 probably null Het
Smarca2 T C 19: 26,630,828 S96P probably damaging Het
Spata31d1c A C 13: 65,036,554 I637L probably benign Het
Ston2 A T 12: 91,740,492 S115T probably damaging Het
Tal2 A C 4: 53,785,999 E60A probably benign Het
Tdpoz3 A T 3: 93,826,140 T41S probably benign Het
Tespa1 T C 10: 130,360,691 I166T probably benign Het
Thsd7a A T 6: 12,555,439 C149S probably damaging Het
Trav6-1 T A 14: 52,638,510 probably benign Het
Txnl4a T C 18: 80,207,264 V25A probably benign Het
Utp4 C A 8: 106,906,276 P297Q probably benign Het
Vmn1r34 T C 6: 66,636,938 Y272C probably damaging Het
Vmn2r112 A T 17: 22,618,486 I643F probably damaging Het
Vmn2r121 C A X: 124,128,140 G728W probably damaging Het
Vmn2r24 T A 6: 123,786,733 S190T probably damaging Het
Zfp507 A G 7: 35,776,010 V926A possibly damaging Het
Other mutations in Ptpro
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Ptpro APN 6 137394909 critical splice donor site probably null
IGL00844:Ptpro APN 6 137414239 missense probably damaging 1.00
IGL00983:Ptpro APN 6 137418248 missense probably benign 0.01
IGL01073:Ptpro APN 6 137377088 missense probably damaging 1.00
IGL01832:Ptpro APN 6 137393668 missense possibly damaging 0.93
IGL02308:Ptpro APN 6 137454700 missense probably benign 0.37
IGL02387:Ptpro APN 6 137410980 missense probably damaging 0.96
IGL02605:Ptpro APN 6 137380318 missense probably benign 0.02
IGL02666:Ptpro APN 6 137378059 missense probably damaging 0.96
IGL03275:Ptpro APN 6 137450006 missense probably damaging 1.00
court UTSW 6 137393675 nonsense probably null
R0017:Ptpro UTSW 6 137416827 missense probably benign 0.03
R0017:Ptpro UTSW 6 137416827 missense probably benign 0.03
R0020:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0022:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0023:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0024:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0094:Ptpro UTSW 6 137386352 missense probably benign 0.08
R0094:Ptpro UTSW 6 137386352 missense probably benign 0.08
R0103:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0106:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0316:Ptpro UTSW 6 137376989 missense possibly damaging 0.81
R0427:Ptpro UTSW 6 137368296 missense possibly damaging 0.81
R0456:Ptpro UTSW 6 137414230 missense probably benign 0.04
R0536:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0537:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0552:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0555:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0664:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0708:Ptpro UTSW 6 137386253 missense probably benign 0.26
R0730:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0735:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0738:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0786:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0811:Ptpro UTSW 6 137368079 missense probably benign 0.00
R0812:Ptpro UTSW 6 137368079 missense probably benign 0.00
R0881:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0973:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1145:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1145:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1146:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1146:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1147:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1147:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1259:Ptpro UTSW 6 137392741 missense probably damaging 0.98
R1340:Ptpro UTSW 6 137441081 missense possibly damaging 0.95
R1382:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1385:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1396:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1401:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1416:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1422:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1448:Ptpro UTSW 6 137441116 missense probably damaging 1.00
R1513:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1518:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1526:Ptpro UTSW 6 137461726 missense probably damaging 1.00
R1540:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1571:Ptpro UTSW 6 137378130 missense probably benign
R1573:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1587:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1588:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1649:Ptpro UTSW 6 137444017 nonsense probably null
R1700:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1701:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1745:Ptpro UTSW 6 137400645 missense probably benign 0.03
R1772:Ptpro UTSW 6 137430743 missense probably damaging 1.00
R1911:Ptpro UTSW 6 137400619 splice site probably benign
R1958:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1967:Ptpro UTSW 6 137416865 missense probably benign 0.38
R2025:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R2026:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R2040:Ptpro UTSW 6 137386164 splice site probably benign
R2115:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R2117:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R2130:Ptpro UTSW 6 137411116 splice site probably null
R2161:Ptpro UTSW 6 137449887 missense probably benign 0.01
R2431:Ptpro UTSW 6 137443585 nonsense probably null
R2915:Ptpro UTSW 6 137414241 start gained probably benign
R2988:Ptpro UTSW 6 137443599 nonsense probably null
R3772:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3773:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3795:Ptpro UTSW 6 137380309 missense probably benign
R3885:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3886:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3887:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3888:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3893:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R4032:Ptpro UTSW 6 137461742 missense probably damaging 1.00
R4133:Ptpro UTSW 6 137420372 missense probably damaging 1.00
R4377:Ptpro UTSW 6 137380266 missense probably benign 0.26
R4455:Ptpro UTSW 6 137393659 missense probably damaging 1.00
R4613:Ptpro UTSW 6 137416836 nonsense probably null
R4827:Ptpro UTSW 6 137442710 missense probably damaging 1.00
R4863:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R4870:Ptpro UTSW 6 137377132 missense probably damaging 0.96
R4910:Ptpro UTSW 6 137368338 missense probably damaging 0.99
R4932:Ptpro UTSW 6 137411105 nonsense probably null
R4941:Ptpro UTSW 6 137392765 missense probably damaging 1.00
R4989:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R5009:Ptpro UTSW 6 137377132 missense probably damaging 0.96
R5032:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R5033:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R5162:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R5393:Ptpro UTSW 6 137380224 missense probably benign 0.04
R5423:Ptpro UTSW 6 137442707 missense probably damaging 1.00
R5782:Ptpro UTSW 6 137399498 missense possibly damaging 0.80
R6103:Ptpro UTSW 6 137400706 missense possibly damaging 0.76
R6239:Ptpro UTSW 6 137380608 missense probably benign 0.28
R6488:Ptpro UTSW 6 137393675 nonsense probably null
R6494:Ptpro UTSW 6 137382642 missense probably benign 0.20
R6746:Ptpro UTSW 6 137394823 missense probably damaging 1.00
R6763:Ptpro UTSW 6 137418281 splice site probably null
R6888:Ptpro UTSW 6 137380200 missense probably benign 0.30
R6983:Ptpro UTSW 6 137449917 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGTGTGATCCTCTGCCAACTTC -3'
(R):5'- CCTTTCAAAAGAATGATGCAGCCCC -3'

Sequencing Primer
(F):5'- TTCGTCATCAGCAAAAACGGC -3'
(R):5'- TGATGCAGCCCCATGAAG -3'
Posted On2014-03-17