Incidental Mutation 'R1381:Pkd2l1'
ID163070
Institutional Source Beutler Lab
Gene Symbol Pkd2l1
Ensembl Gene ENSMUSG00000037578
Gene Namepolycystic kidney disease 2-like 1
SynonymsPCL, PKD2L, Pkdl, polycystin-L, TRPP3
MMRRC Submission 039443-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R1381 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location44147637-44192442 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44150463 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 649 (I649M)
Ref Sequence ENSEMBL: ENSMUSP00000045675 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042026] [ENSMUST00000079033]
Predicted Effect probably benign
Transcript: ENSMUST00000042026
AA Change: I649M

PolyPhen 2 Score 0.079 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000045675
Gene: ENSMUSG00000037578
AA Change: I649M

DomainStartEndE-ValueType
transmembrane domain 105 127 N/A INTRINSIC
Pfam:PKD_channel 145 567 1.3e-172 PFAM
Pfam:Ion_trans 335 572 1.8e-30 PFAM
low complexity region 592 598 N/A INTRINSIC
SCOP:d2pvba_ 616 676 2e-4 SMART
PDB:4GIF|A 698 739 1e-17 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000079033
SMART Domains Protein: ENSMUSP00000078042
Gene: ENSMUSG00000057506

DomainStartEndE-ValueType
low complexity region 22 36 N/A INTRINSIC
Pfam:BLOC1_2 43 138 6.9e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161357
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.4%
  • 20x: 86.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family. The encoded protein contains multiple transmembrane domains, and cytoplasmic N- and C-termini. The protein may be an integral membrane protein involved in cell-cell/matrix interactions. This protein functions as a calcium-regulated nonselective cation channel. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased chorda tympani nerve response to sour tastants. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik C A 2: 68,731,086 F252L probably benign Het
Aadac A T 3: 60,039,930 M350L probably damaging Het
Agtrap G A 4: 148,083,965 T19I probably damaging Het
Apba3 C T 10: 81,271,756 T142M possibly damaging Het
Cd55b T A 1: 130,419,675 K133I probably damaging Het
Cep295 A C 9: 15,322,565 C2312G probably benign Het
Ces1a A G 8: 93,034,031 V231A probably damaging Het
Chdh C A 14: 30,036,834 L579I probably damaging Het
Cyb5r4 T A 9: 87,022,233 S19T probably benign Het
Cyp2d22 C A 15: 82,372,508 R355L probably benign Het
Dach2 T C X: 113,298,775 Y117H probably damaging Het
Dennd4c G A 4: 86,774,532 R93K probably benign Het
Dph2 G T 4: 117,889,668 L452I probably damaging Het
Exoc6b T C 6: 84,835,117 D634G probably benign Het
Fam217b G A 2: 178,420,425 V61I probably benign Het
Fbln7 A C 2: 128,877,379 Q32P probably damaging Het
Fgfr1op2 A G 6: 146,588,741 Y46C probably damaging Het
Fhod3 T A 18: 25,090,471 I958N probably damaging Het
Foxp2 T A 6: 15,409,766 M455K possibly damaging Het
Gabrr2 G A 4: 33,081,420 G152D probably damaging Het
Galntl6 G T 8: 58,472,955 P92Q probably damaging Het
Gm5592 A T 7: 41,286,172 T33S probably benign Het
Grid2ip A T 5: 143,362,651 T166S probably benign Het
Grsf1 G A 5: 88,665,864 S225L probably benign Het
Hadha G T 5: 30,128,836 T395K probably benign Het
Hars2 C T 18: 36,789,217 A295V possibly damaging Het
Hsf5 T A 11: 87,638,169 S577T probably benign Het
Ice2 A G 9: 69,400,527 Y31C probably damaging Het
Ift80 A T 3: 68,914,783 I643N possibly damaging Het
Iglon5 A T 7: 43,476,640 D222E probably benign Het
Ilvbl C A 10: 78,576,596 S50R probably damaging Het
Invs C A 4: 48,421,942 S858* probably null Het
Ipo13 T G 4: 117,904,395 T508P probably damaging Het
Itgb4 T C 11: 115,994,337 I1015T probably benign Het
Kank4 A T 4: 98,779,938 W91R probably damaging Het
Kansl1l C T 1: 66,720,904 A906T probably benign Het
Klk4 G A 7: 43,885,282 V222M probably damaging Het
Lipo4 T A 19: 33,499,341 M336L probably benign Het
Lrig1 T C 6: 94,606,130 N1002D probably benign Het
Lzts3 A G 2: 130,635,299 S524P probably damaging Het
Maz A T 7: 127,023,152 C409* probably null Het
Mmp24 A T 2: 155,814,127 Q495L possibly damaging Het
Mrgpra9 C T 7: 47,235,302 V206I possibly damaging Het
Myof A G 19: 37,995,485 Y124H probably damaging Het
Nalcn A T 14: 123,314,105 V1030D probably damaging Het
Neb T A 2: 52,260,532 I2495F probably damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Nrbf2 G A 10: 67,267,826 T166M probably damaging Het
Nup153 T C 13: 46,689,181 D837G probably damaging Het
Nup210 C A 6: 91,075,960 G331V probably damaging Het
Olfr1143 T C 2: 87,803,136 L245P probably damaging Het
Olfr1447 T C 19: 12,900,956 T275A probably benign Het
Olfr5 A G 7: 6,481,009 probably null Het
Olfr923 T A 9: 38,828,338 S210T probably benign Het
Pabpc4 T A 4: 123,289,059 L163H probably damaging Het
Papd5 T A 8: 88,243,309 M203K possibly damaging Het
Pcdh7 T A 5: 57,721,540 Y126* probably null Het
Pdzd2 A G 15: 12,385,439 S1082P probably benign Het
Plcl2 G A 17: 50,607,729 E589K probably damaging Het
Plppr1 C A 4: 49,337,674 T325N possibly damaging Het
Pqlc1 T G 18: 80,283,314 S126A probably benign Het
Prss8 GCTGCCCAAGTCCC GC 7: 127,929,849 probably benign Het
Ptcd2 A G 13: 99,344,597 S25P probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rusc2 T A 4: 43,416,137 V481E probably damaging Het
Sephs2 G T 7: 127,272,967 T318K probably damaging Het
Sf3b1 T A 1: 55,003,154 I497L probably damaging Het
Slc30a7 C T 3: 115,956,870 probably null Het
Smarca2 T C 19: 26,630,828 S96P probably damaging Het
Spata31d1c A C 13: 65,036,554 I637L probably benign Het
Ston2 A T 12: 91,740,492 S115T probably damaging Het
Tal2 A C 4: 53,785,999 E60A probably benign Het
Tdpoz3 A T 3: 93,826,140 T41S probably benign Het
Tespa1 T C 10: 130,360,691 I166T probably benign Het
Thsd7a A T 6: 12,555,439 C149S probably damaging Het
Trav6-1 T A 14: 52,638,510 probably benign Het
Txnl4a T C 18: 80,207,264 V25A probably benign Het
Utp4 C A 8: 106,906,276 P297Q probably benign Het
Vmn1r34 T C 6: 66,636,938 Y272C probably damaging Het
Vmn2r112 A T 17: 22,618,486 I643F probably damaging Het
Vmn2r121 C A X: 124,128,140 G728W probably damaging Het
Vmn2r24 T A 6: 123,786,733 S190T probably damaging Het
Zfp507 A G 7: 35,776,010 V926A possibly damaging Het
Other mutations in Pkd2l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Pkd2l1 APN 19 44157636 critical splice donor site probably null
IGL00426:Pkd2l1 APN 19 44155605 missense probably benign 0.21
IGL00848:Pkd2l1 APN 19 44192279 utr 5 prime probably benign
IGL01315:Pkd2l1 APN 19 44192196 missense probably benign 0.09
IGL01654:Pkd2l1 APN 19 44154223 missense probably damaging 0.98
IGL01786:Pkd2l1 APN 19 44191442 missense probably damaging 0.96
IGL02174:Pkd2l1 APN 19 44157268 missense probably benign 0.04
IGL02648:Pkd2l1 APN 19 44155536 missense possibly damaging 0.72
R0654:Pkd2l1 UTSW 19 44157631 splice site probably null
R0762:Pkd2l1 UTSW 19 44150470 missense probably benign 0.19
R0981:Pkd2l1 UTSW 19 44154422 critical splice donor site probably null
R1114:Pkd2l1 UTSW 19 44191544 splice site probably benign
R1467:Pkd2l1 UTSW 19 44154209 missense possibly damaging 0.91
R1467:Pkd2l1 UTSW 19 44154209 missense possibly damaging 0.91
R1754:Pkd2l1 UTSW 19 44155601 nonsense probably null
R2009:Pkd2l1 UTSW 19 44155964 missense probably benign 0.01
R2125:Pkd2l1 UTSW 19 44154500 missense possibly damaging 0.91
R2696:Pkd2l1 UTSW 19 44157269 missense probably benign 0.01
R3001:Pkd2l1 UTSW 19 44155557 missense possibly damaging 0.81
R3002:Pkd2l1 UTSW 19 44155557 missense possibly damaging 0.81
R3701:Pkd2l1 UTSW 19 44157227 missense probably damaging 0.99
R4179:Pkd2l1 UTSW 19 44192181 missense probably benign 0.01
R4180:Pkd2l1 UTSW 19 44192181 missense probably benign 0.01
R4614:Pkd2l1 UTSW 19 44154134 missense probably damaging 0.99
R4616:Pkd2l1 UTSW 19 44154134 missense probably damaging 0.99
R4617:Pkd2l1 UTSW 19 44154134 missense probably damaging 0.99
R4618:Pkd2l1 UTSW 19 44154134 missense probably damaging 0.99
R4762:Pkd2l1 UTSW 19 44155621 missense probably benign 0.09
R4893:Pkd2l1 UTSW 19 44153771 missense probably benign 0.00
R4907:Pkd2l1 UTSW 19 44154142 missense possibly damaging 0.95
R5004:Pkd2l1 UTSW 19 44149577 missense probably benign 0.00
R5380:Pkd2l1 UTSW 19 44157732 missense probably benign 0.33
R5480:Pkd2l1 UTSW 19 44192156 missense probably benign 0.18
R5950:Pkd2l1 UTSW 19 44152090 missense probably benign 0.27
R6248:Pkd2l1 UTSW 19 44157669 missense probably benign 0.00
R6908:Pkd2l1 UTSW 19 44152446 missense probably damaging 1.00
R6925:Pkd2l1 UTSW 19 44191508 missense possibly damaging 0.92
R7021:Pkd2l1 UTSW 19 44154208 missense probably damaging 0.98
R7322:Pkd2l1 UTSW 19 44157690 missense probably benign 0.00
R7378:Pkd2l1 UTSW 19 44153715 missense probably benign 0.05
R7442:Pkd2l1 UTSW 19 44157229 missense probably benign 0.01
X0026:Pkd2l1 UTSW 19 44157182 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCATTTGTGGGAGGACATTCAGC -3'
(R):5'- GGCATCTGGTTATTCAGGGGCAAAG -3'

Sequencing Primer
(F):5'- ACATTCAGCTTGGATTTGGC -3'
(R):5'- GATCCTGAAGTTCTAACATAGCCAG -3'
Posted On2014-03-17