Incidental Mutation 'R1381:Vmn2r121'
ID163072
Institutional Source Beutler Lab
Gene Symbol Vmn2r121
Ensembl Gene ENSMUSG00000072049
Gene Namevomeronasal 2, receptor 121
SynonymsEG625699
MMRRC Submission 039443-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R1381 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location124127339-124135910 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 124128140 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Tryptophan at position 728 (G728W)
Ref Sequence ENSEMBL: ENSMUSP00000092067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094491]
Predicted Effect probably damaging
Transcript: ENSMUST00000094491
AA Change: G728W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092067
Gene: ENSMUSG00000072049
AA Change: G728W

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 75 448 3.2e-26 PFAM
Pfam:NCD3G 506 560 2.1e-19 PFAM
Pfam:7tm_3 593 828 3.8e-56 PFAM
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.4%
  • 20x: 86.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik C A 2: 68,731,086 F252L probably benign Het
Aadac A T 3: 60,039,930 M350L probably damaging Het
Agtrap G A 4: 148,083,965 T19I probably damaging Het
Apba3 C T 10: 81,271,756 T142M possibly damaging Het
Cd55b T A 1: 130,419,675 K133I probably damaging Het
Cep295 A C 9: 15,322,565 C2312G probably benign Het
Ces1a A G 8: 93,034,031 V231A probably damaging Het
Chdh C A 14: 30,036,834 L579I probably damaging Het
Cyb5r4 T A 9: 87,022,233 S19T probably benign Het
Cyp2d22 C A 15: 82,372,508 R355L probably benign Het
Dach2 T C X: 113,298,775 Y117H probably damaging Het
Dennd4c G A 4: 86,774,532 R93K probably benign Het
Dph2 G T 4: 117,889,668 L452I probably damaging Het
Exoc6b T C 6: 84,835,117 D634G probably benign Het
Fam217b G A 2: 178,420,425 V61I probably benign Het
Fbln7 A C 2: 128,877,379 Q32P probably damaging Het
Fgfr1op2 A G 6: 146,588,741 Y46C probably damaging Het
Fhod3 T A 18: 25,090,471 I958N probably damaging Het
Foxp2 T A 6: 15,409,766 M455K possibly damaging Het
Gabrr2 G A 4: 33,081,420 G152D probably damaging Het
Galntl6 G T 8: 58,472,955 P92Q probably damaging Het
Gm5592 A T 7: 41,286,172 T33S probably benign Het
Grid2ip A T 5: 143,362,651 T166S probably benign Het
Grsf1 G A 5: 88,665,864 S225L probably benign Het
Hadha G T 5: 30,128,836 T395K probably benign Het
Hars2 C T 18: 36,789,217 A295V possibly damaging Het
Hsf5 T A 11: 87,638,169 S577T probably benign Het
Ice2 A G 9: 69,400,527 Y31C probably damaging Het
Ift80 A T 3: 68,914,783 I643N possibly damaging Het
Iglon5 A T 7: 43,476,640 D222E probably benign Het
Ilvbl C A 10: 78,576,596 S50R probably damaging Het
Invs C A 4: 48,421,942 S858* probably null Het
Ipo13 T G 4: 117,904,395 T508P probably damaging Het
Itgb4 T C 11: 115,994,337 I1015T probably benign Het
Kank4 A T 4: 98,779,938 W91R probably damaging Het
Kansl1l C T 1: 66,720,904 A906T probably benign Het
Klk4 G A 7: 43,885,282 V222M probably damaging Het
Lipo4 T A 19: 33,499,341 M336L probably benign Het
Lrig1 T C 6: 94,606,130 N1002D probably benign Het
Lzts3 A G 2: 130,635,299 S524P probably damaging Het
Maz A T 7: 127,023,152 C409* probably null Het
Mmp24 A T 2: 155,814,127 Q495L possibly damaging Het
Mrgpra9 C T 7: 47,235,302 V206I possibly damaging Het
Myof A G 19: 37,995,485 Y124H probably damaging Het
Nalcn A T 14: 123,314,105 V1030D probably damaging Het
Neb T A 2: 52,260,532 I2495F probably damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Nrbf2 G A 10: 67,267,826 T166M probably damaging Het
Nup153 T C 13: 46,689,181 D837G probably damaging Het
Nup210 C A 6: 91,075,960 G331V probably damaging Het
Olfr1143 T C 2: 87,803,136 L245P probably damaging Het
Olfr1447 T C 19: 12,900,956 T275A probably benign Het
Olfr5 A G 7: 6,481,009 probably null Het
Olfr923 T A 9: 38,828,338 S210T probably benign Het
Pabpc4 T A 4: 123,289,059 L163H probably damaging Het
Papd5 T A 8: 88,243,309 M203K possibly damaging Het
Pcdh7 T A 5: 57,721,540 Y126* probably null Het
Pdzd2 A G 15: 12,385,439 S1082P probably benign Het
Pkd2l1 T C 19: 44,150,463 I649M probably benign Het
Plcl2 G A 17: 50,607,729 E589K probably damaging Het
Plppr1 C A 4: 49,337,674 T325N possibly damaging Het
Pqlc1 T G 18: 80,283,314 S126A probably benign Het
Prss8 GCTGCCCAAGTCCC GC 7: 127,929,849 probably benign Het
Ptcd2 A G 13: 99,344,597 S25P probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rusc2 T A 4: 43,416,137 V481E probably damaging Het
Sephs2 G T 7: 127,272,967 T318K probably damaging Het
Sf3b1 T A 1: 55,003,154 I497L probably damaging Het
Slc30a7 C T 3: 115,956,870 probably null Het
Smarca2 T C 19: 26,630,828 S96P probably damaging Het
Spata31d1c A C 13: 65,036,554 I637L probably benign Het
Ston2 A T 12: 91,740,492 S115T probably damaging Het
Tal2 A C 4: 53,785,999 E60A probably benign Het
Tdpoz3 A T 3: 93,826,140 T41S probably benign Het
Tespa1 T C 10: 130,360,691 I166T probably benign Het
Thsd7a A T 6: 12,555,439 C149S probably damaging Het
Trav6-1 T A 14: 52,638,510 probably benign Het
Txnl4a T C 18: 80,207,264 V25A probably benign Het
Utp4 C A 8: 106,906,276 P297Q probably benign Het
Vmn1r34 T C 6: 66,636,938 Y272C probably damaging Het
Vmn2r112 A T 17: 22,618,486 I643F probably damaging Het
Vmn2r24 T A 6: 123,786,733 S190T probably damaging Het
Zfp507 A G 7: 35,776,010 V926A possibly damaging Het
Other mutations in Vmn2r121
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Vmn2r121 APN X 124127802 missense probably benign 0.04
IGL00990:Vmn2r121 APN X 124127783 missense possibly damaging 0.95
IGL00990:Vmn2r121 APN X 124133716 missense probably benign 0.00
IGL01125:Vmn2r121 APN X 124132807 missense probably damaging 0.99
IGL01450:Vmn2r121 APN X 124131191 missense possibly damaging 0.57
IGL01619:Vmn2r121 APN X 124132300 missense probably benign
IGL01797:Vmn2r121 APN X 124131351 splice site probably benign
IGL02227:Vmn2r121 APN X 124132681 missense probably benign 0.44
IGL02971:Vmn2r121 APN X 124127894 missense probably damaging 1.00
IGL03058:Vmn2r121 APN X 124132921 missense probably benign 0.00
IGL03142:Vmn2r121 APN X 124132938 missense possibly damaging 0.94
IGL03183:Vmn2r121 APN X 124132326 missense probably benign 0.03
E0370:Vmn2r121 UTSW X 124127920 missense probably benign 0.01
R0196:Vmn2r121 UTSW X 124132182 missense probably benign 0.03
R1399:Vmn2r121 UTSW X 124129848 missense possibly damaging 0.94
R1423:Vmn2r121 UTSW X 124129905 missense possibly damaging 0.52
R1687:Vmn2r121 UTSW X 124132791 missense probably benign 0.39
R2121:Vmn2r121 UTSW X 124133742 splice site probably null
R2124:Vmn2r121 UTSW X 124133742 splice site probably null
R3151:Vmn2r121 UTSW X 124131152 missense probably benign 0.20
R4460:Vmn2r121 UTSW X 124128584 missense probably benign 0.01
R4735:Vmn2r121 UTSW X 124128638 missense probably benign
R5332:Vmn2r121 UTSW X 124133575 missense probably benign
R6102:Vmn2r121 UTSW X 124133575 missense probably benign
X0023:Vmn2r121 UTSW X 124135657 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- CCCGCACTAGAAGCCAAGATGG -3'
(R):5'- GGCCAATAACCGCATTCTCAGCTAC -3'

Sequencing Primer
(F):5'- AAGGTGATCCAGACACTGC -3'
(R):5'- CTTGCAGCAAACCATATTTGGAG -3'
Posted On2014-03-17