Incidental Mutation 'R1382:Tub'
ID163091
Institutional Source Beutler Lab
Gene Symbol Tub
Ensembl Gene ENSMUSG00000031028
Gene Nametubby bipartite transcription factor
Synonymsrd5, tub
MMRRC Submission 039444-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1382 (G1)
Quality Score181
Status Not validated
Chromosome7
Chromosomal Location108950338-109034460 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 109030153 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 426 (V426I)
Ref Sequence ENSEMBL: ENSMUSP00000113580 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033341] [ENSMUST00000055993] [ENSMUST00000119474] [ENSMUST00000147580]
Predicted Effect probably damaging
Transcript: ENSMUST00000033341
AA Change: V472I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000033341
Gene: ENSMUSG00000031028
AA Change: V472I

DomainStartEndE-ValueType
Pfam:Tub_N 29 237 2.5e-58 PFAM
Pfam:Tub 257 499 2.4e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000055993
SMART Domains Protein: ENSMUSP00000056990
Gene: ENSMUSG00000048330

DomainStartEndE-ValueType
Pfam:RIC3 15 165 1.2e-38 PFAM
low complexity region 256 272 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119474
AA Change: V426I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000113580
Gene: ENSMUSG00000031028
AA Change: V426I

DomainStartEndE-ValueType
low complexity region 24 41 N/A INTRINSIC
low complexity region 55 77 N/A INTRINSIC
low complexity region 145 174 N/A INTRINSIC
low complexity region 183 196 N/A INTRINSIC
Pfam:Tub 211 453 2.4e-121 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147943
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Tubby family of bipartite transcription factors. The encoded protein may play a role in obesity and sensorineural degradation. The crystal structure has been determined for a similar protein in mouse, and it functions as a membrane-bound transcription regulator that translocates to the nucleus in response to phosphoinositide hydrolysis. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants exhibit a late-developing obesity with hyperinsulinemia, retinal degeneration, and hearing loss associated with death of both outer and inner hair cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago2 C T 15: 73,127,040 C236Y probably benign Het
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Asap2 A G 12: 21,265,954 T916A probably damaging Het
Ceacam5 T C 7: 17,752,165 V529A probably benign Het
Cep192 G A 18: 67,856,299 R1839Q possibly damaging Het
Cope A G 8: 70,312,863 N295S probably benign Het
Crocc2 G A 1: 93,217,093 probably null Het
Cuedc1 C T 11: 88,177,363 P146S probably benign Het
Ddc T C 11: 11,824,856 D345G possibly damaging Het
Dsg4 T A 18: 20,465,124 C700S probably benign Het
Dst A T 1: 34,268,833 E6224D probably damaging Het
Exo1 A G 1: 175,893,796 T334A probably damaging Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Glyr1 GCTGCC G 16: 5,021,345 probably null Het
Gm17727 T A 9: 35,778,094 probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Lemd3 A T 10: 120,931,736 I711K probably damaging Het
Lrrc8b A G 5: 105,480,883 D365G probably damaging Het
Mdga2 A T 12: 66,470,916 I48K possibly damaging Het
Olfr638 G T 7: 104,003,720 L148F probably benign Het
Pdzph1 A G 17: 58,974,747 V180A probably benign Het
Phactr1 T C 13: 43,132,975 F584S probably damaging Het
Ppan A G 9: 20,891,918 K429E probably benign Het
Prkd3 A G 17: 78,957,245 V647A probably damaging Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ptpru A G 4: 131,808,229 F407S probably damaging Het
Rab3gap1 A T 1: 127,942,596 T985S probably damaging Het
Slc5a2 G C 7: 128,270,631 R412P probably damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Tet2 C T 3: 133,476,615 G1196D probably damaging Het
Wdr75 A G 1: 45,817,311 Y498C probably damaging Het
Other mutations in Tub
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01694:Tub APN 7 109021036 splice site probably benign
IGL02715:Tub APN 7 109029310 missense probably benign
grasso UTSW 7 109029650 missense probably damaging 1.00
troy UTSW 7 109020954 nonsense probably null
R0152:Tub UTSW 7 109020927 missense probably damaging 1.00
R0233:Tub UTSW 7 109029341 missense possibly damaging 0.63
R0233:Tub UTSW 7 109029341 missense possibly damaging 0.63
R0317:Tub UTSW 7 109020927 missense probably damaging 1.00
R1395:Tub UTSW 7 109020954 nonsense probably null
R1588:Tub UTSW 7 109029681 missense probably damaging 1.00
R1975:Tub UTSW 7 109027835 missense possibly damaging 0.74
R2047:Tub UTSW 7 109026732 missense probably benign 0.30
R2121:Tub UTSW 7 109026737 missense probably damaging 1.00
R2414:Tub UTSW 7 109027033 missense probably damaging 1.00
R3694:Tub UTSW 7 109027832 missense probably benign
R3695:Tub UTSW 7 109027832 missense probably benign
R4914:Tub UTSW 7 109020954 nonsense probably null
R5139:Tub UTSW 7 109011102 start codon destroyed probably null 0.53
R5347:Tub UTSW 7 109026771 missense possibly damaging 0.67
R5557:Tub UTSW 7 109025718 missense probably damaging 0.99
R6000:Tub UTSW 7 109029650 missense probably damaging 1.00
R6245:Tub UTSW 7 109027058 missense probably damaging 1.00
R6888:Tub UTSW 7 109029298 missense probably null 1.00
R7316:Tub UTSW 7 109030171 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- TTCCAGATCATCCACGGCAATGAC -3'
(R):5'- AGCCCATAGAGGGCCTATGAACAG -3'

Sequencing Primer
(F):5'- GATCTGGTCCATATCAGCCAGTG -3'
(R):5'- CCTATGAACAGAGGGTAGGCAG -3'
Posted On2014-03-17