Incidental Mutation 'R1382:Cope'
ID163093
Institutional Source Beutler Lab
Gene Symbol Cope
Ensembl Gene ENSMUSG00000055681
Gene Namecoatomer protein complex, subunit epsilon
Synonyms1110005D17Rik, Cope1
MMRRC Submission 039444-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock #R1382 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location70302518-70312993 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70312863 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 295 (N295S)
Ref Sequence ENSEMBL: ENSMUSP00000071078 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066469] [ENSMUST00000128003] [ENSMUST00000140239] [ENSMUST00000150968] [ENSMUST00000165819] [ENSMUST00000168018]
Predicted Effect probably benign
Transcript: ENSMUST00000066469
AA Change: N295S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000071078
Gene: ENSMUSG00000055681
AA Change: N295S

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
Pfam:Coatomer_E 15 305 2.8e-134 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128003
SMART Domains Protein: ENSMUSP00000122888
Gene: ENSMUSG00000055681

DomainStartEndE-ValueType
Pfam:Coatomer_E 1 212 5.4e-95 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134822
Predicted Effect probably benign
Transcript: ENSMUST00000140239
SMART Domains Protein: ENSMUSP00000120598
Gene: ENSMUSG00000087408

DomainStartEndE-ValueType
low complexity region 49 68 N/A INTRINSIC
TLC 97 311 1.24e-57 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150968
SMART Domains Protein: ENSMUSP00000119055
Gene: ENSMUSG00000055681

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
Pfam:Coatomer_E 15 227 6.5e-86 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165819
SMART Domains Protein: ENSMUSP00000128325
Gene: ENSMUSG00000087408

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:TGFb_propeptide 33 169 7e-16 PFAM
low complexity region 225 237 N/A INTRINSIC
TGFB 251 357 6.22e-56 SMART
Predicted Effect unknown
Transcript: ENSMUST00000167850
AA Change: N102S
SMART Domains Protein: ENSMUSP00000132976
Gene: ENSMUSG00000055681
AA Change: N102S

DomainStartEndE-ValueType
Pfam:Coatomer_E 1 79 5.4e-38 PFAM
Pfam:Coatomer_E 75 113 3.7e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168018
SMART Domains Protein: ENSMUSP00000130416
Gene: ENSMUSG00000055681

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
Pfam:Coatomer_E 15 79 4.5e-22 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is an epsilon subunit of coatomer protein complex. Coatomer is a cytosolic protein complex that binds to dilysine motifs and reversibly associates with Golgi non-clathrin-coated vesicles. It is required for budding from Golgi membranes, and is essential for the retrograde Golgi-to-ER transport of dilysine-tagged proteins. Coatomer complex consists of at least the alpha, beta, beta', gamma, delta, epsilon and zeta subunits. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago2 C T 15: 73,127,040 C236Y probably benign Het
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Asap2 A G 12: 21,265,954 T916A probably damaging Het
Ceacam5 T C 7: 17,752,165 V529A probably benign Het
Cep192 G A 18: 67,856,299 R1839Q possibly damaging Het
Crocc2 G A 1: 93,217,093 probably null Het
Cuedc1 C T 11: 88,177,363 P146S probably benign Het
Ddc T C 11: 11,824,856 D345G possibly damaging Het
Dsg4 T A 18: 20,465,124 C700S probably benign Het
Dst A T 1: 34,268,833 E6224D probably damaging Het
Exo1 A G 1: 175,893,796 T334A probably damaging Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Glyr1 GCTGCC G 16: 5,021,345 probably null Het
Gm17727 T A 9: 35,778,094 probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Lemd3 A T 10: 120,931,736 I711K probably damaging Het
Lrrc8b A G 5: 105,480,883 D365G probably damaging Het
Mdga2 A T 12: 66,470,916 I48K possibly damaging Het
Olfr638 G T 7: 104,003,720 L148F probably benign Het
Pdzph1 A G 17: 58,974,747 V180A probably benign Het
Phactr1 T C 13: 43,132,975 F584S probably damaging Het
Ppan A G 9: 20,891,918 K429E probably benign Het
Prkd3 A G 17: 78,957,245 V647A probably damaging Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ptpru A G 4: 131,808,229 F407S probably damaging Het
Rab3gap1 A T 1: 127,942,596 T985S probably damaging Het
Slc5a2 G C 7: 128,270,631 R412P probably damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Tet2 C T 3: 133,476,615 G1196D probably damaging Het
Tub G A 7: 109,030,153 V426I probably damaging Het
Wdr75 A G 1: 45,817,311 Y498C probably damaging Het
Other mutations in Cope
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02696:Cope APN 8 70310493 critical splice donor site probably null
R0570:Cope UTSW 8 70306531 missense probably damaging 0.96
R1518:Cope UTSW 8 70312761 missense possibly damaging 0.72
R4538:Cope UTSW 8 70306507 missense probably damaging 1.00
R4941:Cope UTSW 8 70302934 critical splice donor site probably null
R5106:Cope UTSW 8 70310447 missense possibly damaging 0.57
R5454:Cope UTSW 8 70304656 missense probably benign 0.17
R5764:Cope UTSW 8 70306581 missense probably damaging 1.00
R5979:Cope UTSW 8 70302543 unclassified probably null
R6003:Cope UTSW 8 70304635 missense probably benign 0.01
R6010:Cope UTSW 8 70308512 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACTCTCTTCAGGTGACAAACCG -3'
(R):5'- TCCCTGGATGCTGATTGAGGCAAC -3'

Sequencing Primer
(F):5'- TGACAAACCGATACTTGTCACAG -3'
(R):5'- TACCCTGAAGCTTAGAGTGCAG -3'
Posted On2014-03-17