Incidental Mutation 'R1382:Pdzph1'
ID163111
Institutional Source Beutler Lab
Gene Symbol Pdzph1
Ensembl Gene ENSMUSG00000024227
Gene NamePDZ and pleckstrin homology domains 1
Synonyms2610034M16Rik
MMRRC Submission 039444-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R1382 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location58878808-58991375 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58974747 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 180 (V180A)
Ref Sequence ENSEMBL: ENSMUSP00000025064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025064]
Predicted Effect probably benign
Transcript: ENSMUST00000025064
AA Change: V180A

PolyPhen 2 Score 0.099 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000025064
Gene: ENSMUSG00000024227
AA Change: V180A

DomainStartEndE-ValueType
Blast:PDZ 780 844 6e-20 BLAST
PDZ 915 984 3.31e-15 SMART
PH 993 1096 9.4e-19 SMART
PH 1120 1218 2.83e-13 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago2 C T 15: 73,127,040 C236Y probably benign Het
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Asap2 A G 12: 21,265,954 T916A probably damaging Het
Ceacam5 T C 7: 17,752,165 V529A probably benign Het
Cep192 G A 18: 67,856,299 R1839Q possibly damaging Het
Cope A G 8: 70,312,863 N295S probably benign Het
Crocc2 G A 1: 93,217,093 probably null Het
Cuedc1 C T 11: 88,177,363 P146S probably benign Het
Ddc T C 11: 11,824,856 D345G possibly damaging Het
Dsg4 T A 18: 20,465,124 C700S probably benign Het
Dst A T 1: 34,268,833 E6224D probably damaging Het
Exo1 A G 1: 175,893,796 T334A probably damaging Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Glyr1 GCTGCC G 16: 5,021,345 probably null Het
Gm17727 T A 9: 35,778,094 probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Lemd3 A T 10: 120,931,736 I711K probably damaging Het
Lrrc8b A G 5: 105,480,883 D365G probably damaging Het
Mdga2 A T 12: 66,470,916 I48K possibly damaging Het
Olfr638 G T 7: 104,003,720 L148F probably benign Het
Phactr1 T C 13: 43,132,975 F584S probably damaging Het
Ppan A G 9: 20,891,918 K429E probably benign Het
Prkd3 A G 17: 78,957,245 V647A probably damaging Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ptpru A G 4: 131,808,229 F407S probably damaging Het
Rab3gap1 A T 1: 127,942,596 T985S probably damaging Het
Slc5a2 G C 7: 128,270,631 R412P probably damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Tet2 C T 3: 133,476,615 G1196D probably damaging Het
Tub G A 7: 109,030,153 V426I probably damaging Het
Wdr75 A G 1: 45,817,311 Y498C probably damaging Het
Other mutations in Pdzph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Pdzph1 APN 17 58974796 missense possibly damaging 0.46
IGL00644:Pdzph1 APN 17 58888110 missense probably benign
IGL01413:Pdzph1 APN 17 58879152 missense possibly damaging 0.82
IGL01530:Pdzph1 APN 17 58922715 missense probably damaging 1.00
IGL02089:Pdzph1 APN 17 58967339 missense possibly damaging 0.92
IGL02201:Pdzph1 APN 17 58967511 splice site probably benign
IGL02548:Pdzph1 APN 17 58973391 missense probably benign 0.10
IGL02618:Pdzph1 APN 17 58879073 utr 3 prime probably benign
IGL02660:Pdzph1 APN 17 58880647 missense probably damaging 0.97
IGL02749:Pdzph1 APN 17 58932483 missense possibly damaging 0.95
IGL02876:Pdzph1 APN 17 58974069 missense probably benign
IGL03304:Pdzph1 APN 17 58880646 missense probably damaging 1.00
IGL03336:Pdzph1 APN 17 58974234 missense probably benign 0.00
R0008:Pdzph1 UTSW 17 58922761 splice site probably benign
R0008:Pdzph1 UTSW 17 58922761 splice site probably benign
R0498:Pdzph1 UTSW 17 58973830 missense probably benign 0.00
R0553:Pdzph1 UTSW 17 58922727 missense probably damaging 1.00
R0594:Pdzph1 UTSW 17 58954479 missense possibly damaging 0.76
R1306:Pdzph1 UTSW 17 58932432 missense possibly damaging 0.90
R1370:Pdzph1 UTSW 17 58974087 missense possibly damaging 0.73
R1463:Pdzph1 UTSW 17 58932445 missense probably damaging 1.00
R1766:Pdzph1 UTSW 17 58973752 missense probably benign 0.16
R1773:Pdzph1 UTSW 17 58974813 missense probably damaging 0.98
R1862:Pdzph1 UTSW 17 58922583 missense probably damaging 1.00
R2070:Pdzph1 UTSW 17 58974097 missense probably benign 0.04
R2071:Pdzph1 UTSW 17 58974097 missense probably benign 0.04
R2229:Pdzph1 UTSW 17 58932412 splice site probably benign
R2264:Pdzph1 UTSW 17 58888167 critical splice acceptor site probably null
R2334:Pdzph1 UTSW 17 58922649 missense probably damaging 1.00
R3750:Pdzph1 UTSW 17 58973336 nonsense probably null
R4700:Pdzph1 UTSW 17 58974546 missense probably damaging 0.98
R4847:Pdzph1 UTSW 17 58973530 missense possibly damaging 0.95
R4868:Pdzph1 UTSW 17 58974756 missense probably benign 0.00
R5130:Pdzph1 UTSW 17 58922609 missense probably damaging 1.00
R5329:Pdzph1 UTSW 17 58974880 missense probably damaging 1.00
R5574:Pdzph1 UTSW 17 58973947 missense probably benign 0.00
R5770:Pdzph1 UTSW 17 58879151 missense probably damaging 1.00
R5795:Pdzph1 UTSW 17 58885867 missense possibly damaging 0.47
R5842:Pdzph1 UTSW 17 58974412 missense possibly damaging 0.64
R5851:Pdzph1 UTSW 17 58973746 missense probably benign 0.02
R6158:Pdzph1 UTSW 17 58973627 missense probably damaging 0.96
R6813:Pdzph1 UTSW 17 58974436 missense probably benign 0.08
R7022:Pdzph1 UTSW 17 58974126 missense probably benign 0.02
R7395:Pdzph1 UTSW 17 58879159 missense possibly damaging 0.85
X0028:Pdzph1 UTSW 17 58879121 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATGCCAGGCTGTGAAGCAGACTC -3'
(R):5'- AATGGTTACACTCCTCCGGCCATC -3'

Sequencing Primer
(F):5'- GCAGACTCACAGGGTTCATC -3'
(R):5'- CTCAACTAGAGGAAGTCTTACCAGTG -3'
Posted On2014-03-17