Incidental Mutation 'R1383:Gm4778'
ID163127
Institutional Source Beutler Lab
Gene Symbol Gm4778
Ensembl Gene ENSMUSG00000089696
Gene Namepredicted gene 4778
Synonyms
MMRRC Submission 039445-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.920) question?
Stock #R1383 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location94264036-94266784 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 94265795 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 37 (M37V)
Ref Sequence ENSEMBL: ENSMUSP00000096477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098878] [ENSMUST00000159517]
Predicted Effect probably benign
Transcript: ENSMUST00000098878
AA Change: M37V

PolyPhen 2 Score 0.166 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000096477
Gene: ENSMUSG00000089696
AA Change: M37V

DomainStartEndE-ValueType
MATH 25 134 6.01e-8 SMART
BTB 192 291 7.66e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159517
AA Change: M33V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000123868
Gene: ENSMUSG00000089696
AA Change: M33V

DomainStartEndE-ValueType
MATH 21 130 6.01e-8 SMART
BTB 188 287 7.66e-26 SMART
Meta Mutation Damage Score 0.122 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 88.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asph T A 4: 9,537,807 probably null Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Eef1akmt1 A G 14: 57,558,032 probably null Het
Ext2 T C 2: 93,806,113 T219A possibly damaging Het
F5 G C 1: 164,198,917 R1686P probably damaging Het
Fat2 G A 11: 55,310,773 H492Y probably benign Het
Glyr1 GCTGCC G 16: 5,021,345 probably null Het
Kcmf1 A G 6: 72,849,582 F155L possibly damaging Het
Miox G A 15: 89,335,042 R29Q probably damaging Het
Mmrn1 A G 6: 60,976,322 Y529C probably damaging Het
Msmo1 G A 8: 64,723,645 T116I probably benign Het
Olfr1090 C T 2: 86,754,494 M81I possibly damaging Het
Olfr1107 A G 2: 87,071,792 L114P probably damaging Het
Olfr1259 A T 2: 89,943,551 M188K probably benign Het
Olfr229 A T 9: 39,909,864 K20N probably benign Het
Ptpn6 A G 6: 124,721,893 I486T probably damaging Het
Slc12a8 T C 16: 33,534,987 F58L probably damaging Het
Slc5a2 G C 7: 128,270,631 R412P probably damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Snrnp200 T C 2: 127,218,411 I525T probably benign Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Znrf3 G C 11: 5,281,994 F410L probably damaging Het
Other mutations in Gm4778
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01767:Gm4778 APN 3 94266484 missense probably benign 0.00
IGL02032:Gm4778 APN 3 94266333 missense probably damaging 1.00
IGL02694:Gm4778 APN 3 94266152 missense probably benign
IGL03171:Gm4778 APN 3 94266455 missense probably benign 0.00
R0195:Gm4778 UTSW 3 94265922 missense possibly damaging 0.79
R0739:Gm4778 UTSW 3 94265795 missense probably benign 0.17
R1064:Gm4778 UTSW 3 94265795 missense probably benign 0.17
R1149:Gm4778 UTSW 3 94265795 missense probably benign 0.17
R1149:Gm4778 UTSW 3 94265795 missense probably benign 0.17
R1150:Gm4778 UTSW 3 94265795 missense probably benign 0.17
R1152:Gm4778 UTSW 3 94265795 missense probably benign 0.17
R1284:Gm4778 UTSW 3 94265795 missense probably benign 0.17
R1286:Gm4778 UTSW 3 94265795 missense probably benign 0.17
R1287:Gm4778 UTSW 3 94265795 missense probably benign 0.17
R1349:Gm4778 UTSW 3 94266128 missense possibly damaging 0.94
R1358:Gm4778 UTSW 3 94265795 missense probably benign 0.17
R1372:Gm4778 UTSW 3 94266128 missense possibly damaging 0.94
R1399:Gm4778 UTSW 3 94265795 missense probably benign 0.17
R1756:Gm4778 UTSW 3 94266218 missense probably benign
R1996:Gm4778 UTSW 3 94265711 missense probably benign 0.00
R2679:Gm4778 UTSW 3 94265910 missense probably damaging 1.00
R2878:Gm4778 UTSW 3 94266480 missense possibly damaging 0.69
R5108:Gm4778 UTSW 3 94265835 missense probably damaging 1.00
R5706:Gm4778 UTSW 3 94266652 missense possibly damaging 0.91
R6251:Gm4778 UTSW 3 94265901 missense probably damaging 1.00
R6928:Gm4778 UTSW 3 94266548 missense probably benign 0.31
R7091:Gm4778 UTSW 3 94266638 missense probably damaging 1.00
R7264:Gm4778 UTSW 3 94265738 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- AGGGAGAGGGAGATTTAAAACTCACCAT -3'
(R):5'- TCACCTGGCAGCAGAGGGTAA -3'

Sequencing Primer
(F):5'- TGGGGAAATTTAGGAGAAATTGACAC -3'
(R):5'- GAAAGCTAACGACTTTCGTGCTC -3'
Posted On2014-03-17