Incidental Mutation 'R1384:Catip'
ID163143
Institutional Source Beutler Lab
Gene Symbol Catip
Ensembl Gene ENSMUSG00000073650
Gene Nameciliogenesis associated TTC17 interacting protein
SynonymsGm216, LOC241112
MMRRC Submission 039446-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R1384 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location74362108-74369321 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 74364363 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 153 (D153G)
Ref Sequence ENSEMBL: ENSMUSP00000117442 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097697] [ENSMUST00000128445] [ENSMUST00000191010]
Predicted Effect probably benign
Transcript: ENSMUST00000097697
AA Change: D109G

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000095303
Gene: ENSMUSG00000073650
AA Change: D109G

DomainStartEndE-ValueType
low complexity region 67 83 N/A INTRINSIC
low complexity region 299 307 N/A INTRINSIC
coiled coil region 341 383 N/A INTRINSIC
low complexity region 473 499 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128445
AA Change: D153G

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000117442
Gene: ENSMUSG00000073650
AA Change: D153G

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
low complexity region 111 127 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186688
Predicted Effect probably benign
Transcript: ENSMUST00000191010
AA Change: D128G

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000141181
Gene: ENSMUSG00000073650
AA Change: D128G

DomainStartEndE-ValueType
low complexity region 86 102 N/A INTRINSIC
low complexity region 318 326 N/A INTRINSIC
coiled coil region 360 402 N/A INTRINSIC
low complexity region 492 518 N/A INTRINSIC
Meta Mutation Damage Score 0.082 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.1%
Validation Efficiency 96% (54/56)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930408O17Rik G A 12: 104,871,192 noncoding transcript Het
A930033H14Rik A G 10: 69,212,361 probably benign Het
Abcf3 G A 16: 20,559,303 G522R probably damaging Het
Abi3bp A G 16: 56,574,499 Y190C probably damaging Het
Alg10b A G 15: 90,227,582 K210E possibly damaging Het
Amph G A 13: 19,142,028 V643M probably damaging Het
C9 G A 15: 6,458,934 V90I probably benign Het
Cacna1s A G 1: 136,094,971 I634V probably benign Het
Cpt1c G A 7: 44,960,924 probably benign Het
Cyp2c23 A G 19: 44,013,663 S296P probably damaging Het
Cyp2d41-ps G A 15: 82,779,517 noncoding transcript Het
Edc4 T A 8: 105,892,382 I1327N probably damaging Het
Fbxl18 G A 5: 142,886,223 A419V probably damaging Het
Filip1l A G 16: 57,571,289 K509E possibly damaging Het
Golga4 A G 9: 118,565,651 E96G probably damaging Het
Grid2ip T G 5: 143,386,096 probably null Het
Gucy1a2 A C 9: 3,759,620 E475D probably damaging Het
Hipk1 A G 3: 103,758,774 probably benign Het
Ica1 G A 6: 8,742,262 Q124* probably null Het
Igsf3 T C 3: 101,451,296 probably null Het
Matn2 A G 15: 34,409,810 E462G probably benign Het
Men1 T C 19: 6,339,891 S464P probably benign Het
Mrgpra2b T A 7: 47,463,994 E330V probably damaging Het
Myoz2 A T 3: 123,026,116 S65T probably damaging Het
Nckap1 A G 2: 80,533,670 M492T possibly damaging Het
Nhsl1 A T 10: 18,408,513 K67N probably null Het
Nostrin A G 2: 69,189,062 R484G probably benign Het
Olfr936 T A 9: 39,046,904 I172F possibly damaging Het
Otog T A 7: 46,273,695 probably benign Het
P2rx5 A G 11: 73,167,890 Y300C probably damaging Het
Pars2 T C 4: 106,653,716 F232L possibly damaging Het
Pi4ka A G 16: 17,297,537 probably benign Het
Pld3 A G 7: 27,537,657 S266P probably benign Het
Pole G A 5: 110,323,664 V1425M possibly damaging Het
Prss43 A G 9: 110,827,442 I66V probably benign Het
Rtn4 A T 11: 29,736,437 N264I probably damaging Het
Slc45a2 A G 15: 11,025,746 Y394C probably benign Het
Speer4f2 A T 5: 17,374,449 N82I probably damaging Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Strip1 T C 3: 107,626,839 S160G probably benign Het
Tbx2 A G 11: 85,833,492 K129R probably benign Het
Tfr2 T C 5: 137,586,820 probably benign Het
Thap12 T C 7: 98,703,438 S17P probably damaging Het
Timm21 G C 18: 84,949,262 L130V probably damaging Het
Tspear T C 10: 77,866,332 F200L probably benign Het
Tspyl5 T A 15: 33,687,380 R140W possibly damaging Het
Ttn T C 2: 76,775,658 D18236G probably damaging Het
Upf2 G A 2: 5,960,989 R140Q unknown Het
Vps4a T A 8: 107,036,644 I10N possibly damaging Het
Other mutations in Catip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01546:Catip APN 1 74362795 missense probably damaging 1.00
IGL01774:Catip APN 1 74368483 missense probably damaging 1.00
IGL02532:Catip APN 1 74364616 missense probably damaging 0.97
IGL03117:Catip APN 1 74364585 missense probably null 0.02
R0165:Catip UTSW 1 74368469 missense possibly damaging 0.93
R0760:Catip UTSW 1 74362959 splice site probably benign
R1538:Catip UTSW 1 74364652 nonsense probably null
R1710:Catip UTSW 1 74362770 missense possibly damaging 0.93
R2255:Catip UTSW 1 74369000 unclassified probably benign
R2323:Catip UTSW 1 74363278 missense probably benign 0.03
R4429:Catip UTSW 1 74368732 unclassified probably benign
R4630:Catip UTSW 1 74368913 unclassified probably benign
R5249:Catip UTSW 1 74362795 missense probably damaging 1.00
R6057:Catip UTSW 1 74362918 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCATCTTTTtgtctgcttgcccg -3'
(R):5'- ACTCTCAGCAGCACCACATTGG -3'

Sequencing Primer
(F):5'- actaagattgactgcatttgcc -3'
(R):5'- ACATTGGCTGCACTGGAGAC -3'
Posted On2014-03-17