Incidental Mutation 'R1384:Igsf3'
ID163150
Institutional Source Beutler Lab
Gene Symbol Igsf3
Ensembl Gene ENSMUSG00000042035
Gene Nameimmunoglobulin superfamily, member 3
Synonyms1700016K10Rik, 4833439O17Rik, 2810035F16Rik
MMRRC Submission 039446-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.302) question?
Stock #R1384 (G1)
Quality Score178
Status Validated
Chromosome3
Chromosomal Location101377083-101463059 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 101451296 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043983] [ENSMUST00000195164]
Predicted Effect probably null
Transcript: ENSMUST00000043983
SMART Domains Protein: ENSMUSP00000048900
Gene: ENSMUSG00000042035

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 27 142 7.7e-5 SMART
IG 152 275 1.99e-7 SMART
IG 287 405 1.79e0 SMART
IG 417 539 6.26e-5 SMART
IG 553 674 3.16e-1 SMART
IG 686 811 4.89e-7 SMART
IG 823 947 8.38e-6 SMART
IG 959 1109 6.97e-3 SMART
transmembrane domain 1125 1147 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000195164
SMART Domains Protein: ENSMUSP00000141823
Gene: ENSMUSG00000042035

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 27 142 3.1e-7 SMART
IG 152 275 8.2e-10 SMART
IG 287 405 7.4e-3 SMART
IG 437 559 2.5e-7 SMART
IG 573 694 1.3e-3 SMART
IG 706 831 1.9e-9 SMART
IG 843 967 3.4e-8 SMART
IG 979 1129 2.9e-5 SMART
transmembrane domain 1145 1167 N/A INTRINSIC
Meta Mutation Damage Score 0.582 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.1%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an immunoglobulin-like membrane protein containing several V-type Ig-like domains. A mutation in this gene has been associated with bilateral nasolacrimal duct obstruction (LCDD). [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930408O17Rik G A 12: 104,871,192 noncoding transcript Het
A930033H14Rik A G 10: 69,212,361 probably benign Het
Abcf3 G A 16: 20,559,303 G522R probably damaging Het
Abi3bp A G 16: 56,574,499 Y190C probably damaging Het
Alg10b A G 15: 90,227,582 K210E possibly damaging Het
Amph G A 13: 19,142,028 V643M probably damaging Het
C9 G A 15: 6,458,934 V90I probably benign Het
Cacna1s A G 1: 136,094,971 I634V probably benign Het
Catip A G 1: 74,364,363 D153G probably benign Het
Cpt1c G A 7: 44,960,924 probably benign Het
Cyp2c23 A G 19: 44,013,663 S296P probably damaging Het
Cyp2d41-ps G A 15: 82,779,517 noncoding transcript Het
Edc4 T A 8: 105,892,382 I1327N probably damaging Het
Fbxl18 G A 5: 142,886,223 A419V probably damaging Het
Filip1l A G 16: 57,571,289 K509E possibly damaging Het
Golga4 A G 9: 118,565,651 E96G probably damaging Het
Grid2ip T G 5: 143,386,096 probably null Het
Gucy1a2 A C 9: 3,759,620 E475D probably damaging Het
Hipk1 A G 3: 103,758,774 probably benign Het
Ica1 G A 6: 8,742,262 Q124* probably null Het
Matn2 A G 15: 34,409,810 E462G probably benign Het
Men1 T C 19: 6,339,891 S464P probably benign Het
Mrgpra2b T A 7: 47,463,994 E330V probably damaging Het
Myoz2 A T 3: 123,026,116 S65T probably damaging Het
Nckap1 A G 2: 80,533,670 M492T possibly damaging Het
Nhsl1 A T 10: 18,408,513 K67N probably null Het
Nostrin A G 2: 69,189,062 R484G probably benign Het
Olfr936 T A 9: 39,046,904 I172F possibly damaging Het
Otog T A 7: 46,273,695 probably benign Het
P2rx5 A G 11: 73,167,890 Y300C probably damaging Het
Pars2 T C 4: 106,653,716 F232L possibly damaging Het
Pi4ka A G 16: 17,297,537 probably benign Het
Pld3 A G 7: 27,537,657 S266P probably benign Het
Pole G A 5: 110,323,664 V1425M possibly damaging Het
Prss43 A G 9: 110,827,442 I66V probably benign Het
Rtn4 A T 11: 29,736,437 N264I probably damaging Het
Slc45a2 A G 15: 11,025,746 Y394C probably benign Het
Speer4f2 A T 5: 17,374,449 N82I probably damaging Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Strip1 T C 3: 107,626,839 S160G probably benign Het
Tbx2 A G 11: 85,833,492 K129R probably benign Het
Tfr2 T C 5: 137,586,820 probably benign Het
Thap12 T C 7: 98,703,438 S17P probably damaging Het
Timm21 G C 18: 84,949,262 L130V probably damaging Het
Tspear T C 10: 77,866,332 F200L probably benign Het
Tspyl5 T A 15: 33,687,380 R140W possibly damaging Het
Ttn T C 2: 76,775,658 D18236G probably damaging Het
Upf2 G A 2: 5,960,989 R140Q unknown Het
Vps4a T A 8: 107,036,644 I10N possibly damaging Het
Other mutations in Igsf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00783:Igsf3 APN 3 101431239 missense probably damaging 0.99
IGL00907:Igsf3 APN 3 101427448 splice site probably benign
IGL01321:Igsf3 APN 3 101427022 splice site probably benign
IGL01340:Igsf3 APN 3 101439679 nonsense probably null
IGL02291:Igsf3 APN 3 101439529 missense probably damaging 1.00
R0090:Igsf3 UTSW 3 101435652 missense probably damaging 1.00
R0143:Igsf3 UTSW 3 101435601 missense probably damaging 1.00
R0418:Igsf3 UTSW 3 101435435 missense probably damaging 0.99
R0711:Igsf3 UTSW 3 101427393 missense probably benign 0.31
R1195:Igsf3 UTSW 3 101458103 missense probably benign 0.05
R1195:Igsf3 UTSW 3 101458103 missense probably benign 0.05
R1195:Igsf3 UTSW 3 101458103 missense probably benign 0.05
R1594:Igsf3 UTSW 3 101451077 nonsense probably null
R1624:Igsf3 UTSW 3 101455227 missense probably benign 0.37
R1766:Igsf3 UTSW 3 101431282 missense probably damaging 1.00
R1988:Igsf3 UTSW 3 101431296 missense probably benign 0.03
R2072:Igsf3 UTSW 3 101439515 missense probably benign 0.02
R4707:Igsf3 UTSW 3 101458094 missense probably benign 0.06
R4976:Igsf3 UTSW 3 101439361 splice site probably null
R4982:Igsf3 UTSW 3 101435667 missense probably benign 0.42
R5008:Igsf3 UTSW 3 101450917 missense probably damaging 0.97
R5119:Igsf3 UTSW 3 101439361 splice site probably null
R5189:Igsf3 UTSW 3 101431527 missense possibly damaging 0.64
R5456:Igsf3 UTSW 3 101427221 missense probably benign 0.20
R5776:Igsf3 UTSW 3 101425480 missense probably benign 0.01
R6112:Igsf3 UTSW 3 101451006 missense probably damaging 1.00
R6383:Igsf3 UTSW 3 101435648 missense probably benign 0.05
R6758:Igsf3 UTSW 3 101425498 missense probably damaging 0.98
X0027:Igsf3 UTSW 3 101435645 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTTCACAAACCCTCGGACGC -3'
(R):5'- TACAGTTGACGCACCTGCAACC -3'

Sequencing Primer
(F):5'- TTCGAGTACGGGACCTACG -3'
(R):5'- ATGTGGGGTGCAgtgtgtg -3'
Posted On2014-03-17