Incidental Mutation 'R1384:Hipk1'
ID163151
Institutional Source Beutler Lab
Gene Symbol Hipk1
Ensembl Gene ENSMUSG00000008730
Gene Namehomeodomain interacting protein kinase 1
Synonyms1110062K04Rik, Myak
MMRRC Submission 039446-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1384 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location103739815-103791563 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 103758774 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029438] [ENSMUST00000106845] [ENSMUST00000118317] [ENSMUST00000137078]
Predicted Effect probably benign
Transcript: ENSMUST00000029438
SMART Domains Protein: ENSMUSP00000029438
Gene: ENSMUSG00000008730

DomainStartEndE-ValueType
low complexity region 3 21 N/A INTRINSIC
low complexity region 87 99 N/A INTRINSIC
low complexity region 151 170 N/A INTRINSIC
S_TKc 190 518 3.39e-76 SMART
low complexity region 586 603 N/A INTRINSIC
low complexity region 679 695 N/A INTRINSIC
low complexity region 941 959 N/A INTRINSIC
low complexity region 1047 1063 N/A INTRINSIC
low complexity region 1095 1111 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106845
SMART Domains Protein: ENSMUSP00000102458
Gene: ENSMUSG00000008730

DomainStartEndE-ValueType
low complexity region 3 21 N/A INTRINSIC
low complexity region 87 99 N/A INTRINSIC
low complexity region 151 170 N/A INTRINSIC
S_TKc 190 518 3.39e-76 SMART
low complexity region 586 603 N/A INTRINSIC
low complexity region 679 695 N/A INTRINSIC
low complexity region 896 914 N/A INTRINSIC
low complexity region 1002 1018 N/A INTRINSIC
low complexity region 1050 1066 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118317
SMART Domains Protein: ENSMUSP00000113998
Gene: ENSMUSG00000008730

DomainStartEndE-ValueType
low complexity region 3 21 N/A INTRINSIC
low complexity region 87 99 N/A INTRINSIC
low complexity region 151 170 N/A INTRINSIC
S_TKc 190 518 3.39e-76 SMART
low complexity region 586 603 N/A INTRINSIC
low complexity region 679 695 N/A INTRINSIC
low complexity region 941 959 N/A INTRINSIC
low complexity region 1047 1063 N/A INTRINSIC
low complexity region 1095 1111 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135634
Predicted Effect probably benign
Transcript: ENSMUST00000137078
SMART Domains Protein: ENSMUSP00000120396
Gene: ENSMUSG00000008730

DomainStartEndE-ValueType
low complexity region 3 21 N/A INTRINSIC
low complexity region 87 99 N/A INTRINSIC
low complexity region 151 170 N/A INTRINSIC
S_TKc 190 518 3.39e-76 SMART
low complexity region 586 603 N/A INTRINSIC
low complexity region 672 695 N/A INTRINSIC
Meta Mutation Damage Score 0.0836 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.1%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the Ser/Thr family of protein kinases and HIPK subfamily. It phosphorylates homeodomain transcription factors and may also function as a co-repressor for homeodomain transcription factors. Alternative splicing results in four transcript variants encoding four distinct isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and fertile, do not develop spontaneous tumors, and are resistant to DMBA-induced skin tumor formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930408O17Rik G A 12: 104,871,192 noncoding transcript Het
A930033H14Rik A G 10: 69,212,361 probably benign Het
Abcf3 G A 16: 20,559,303 G522R probably damaging Het
Abi3bp A G 16: 56,574,499 Y190C probably damaging Het
Alg10b A G 15: 90,227,582 K210E possibly damaging Het
Amph G A 13: 19,142,028 V643M probably damaging Het
C9 G A 15: 6,458,934 V90I probably benign Het
Cacna1s A G 1: 136,094,971 I634V probably benign Het
Catip A G 1: 74,364,363 D153G probably benign Het
Cpt1c G A 7: 44,960,924 probably benign Het
Cyp2c23 A G 19: 44,013,663 S296P probably damaging Het
Cyp2d41-ps G A 15: 82,779,517 noncoding transcript Het
Edc4 T A 8: 105,892,382 I1327N probably damaging Het
Fbxl18 G A 5: 142,886,223 A419V probably damaging Het
Filip1l A G 16: 57,571,289 K509E possibly damaging Het
Golga4 A G 9: 118,565,651 E96G probably damaging Het
Grid2ip T G 5: 143,386,096 probably null Het
Gucy1a2 A C 9: 3,759,620 E475D probably damaging Het
Ica1 G A 6: 8,742,262 Q124* probably null Het
Igsf3 T C 3: 101,451,296 probably null Het
Matn2 A G 15: 34,409,810 E462G probably benign Het
Men1 T C 19: 6,339,891 S464P probably benign Het
Mrgpra2b T A 7: 47,463,994 E330V probably damaging Het
Myoz2 A T 3: 123,026,116 S65T probably damaging Het
Nckap1 A G 2: 80,533,670 M492T possibly damaging Het
Nhsl1 A T 10: 18,408,513 K67N probably null Het
Nostrin A G 2: 69,189,062 R484G probably benign Het
Olfr936 T A 9: 39,046,904 I172F possibly damaging Het
Otog T A 7: 46,273,695 probably benign Het
P2rx5 A G 11: 73,167,890 Y300C probably damaging Het
Pars2 T C 4: 106,653,716 F232L possibly damaging Het
Pi4ka A G 16: 17,297,537 probably benign Het
Pld3 A G 7: 27,537,657 S266P probably benign Het
Pole G A 5: 110,323,664 V1425M possibly damaging Het
Prss43 A G 9: 110,827,442 I66V probably benign Het
Rtn4 A T 11: 29,736,437 N264I probably damaging Het
Slc45a2 A G 15: 11,025,746 Y394C probably benign Het
Speer4f2 A T 5: 17,374,449 N82I probably damaging Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Strip1 T C 3: 107,626,839 S160G probably benign Het
Tbx2 A G 11: 85,833,492 K129R probably benign Het
Tfr2 T C 5: 137,586,820 probably benign Het
Thap12 T C 7: 98,703,438 S17P probably damaging Het
Timm21 G C 18: 84,949,262 L130V probably damaging Het
Tspear T C 10: 77,866,332 F200L probably benign Het
Tspyl5 T A 15: 33,687,380 R140W possibly damaging Het
Ttn T C 2: 76,775,658 D18236G probably damaging Het
Upf2 G A 2: 5,960,989 R140Q unknown Het
Vps4a T A 8: 107,036,644 I10N possibly damaging Het
Other mutations in Hipk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00792:Hipk1 APN 3 103778160 missense possibly damaging 0.49
IGL01024:Hipk1 APN 3 103760636 missense probably benign 0.31
IGL01069:Hipk1 APN 3 103777699 missense possibly damaging 0.95
IGL01798:Hipk1 APN 3 103761559 missense probably damaging 0.99
IGL01937:Hipk1 APN 3 103744004 missense possibly damaging 0.71
IGL01945:Hipk1 APN 3 103744004 missense possibly damaging 0.71
IGL02184:Hipk1 APN 3 103758750 missense possibly damaging 0.96
IGL02430:Hipk1 APN 3 103760655 missense probably damaging 1.00
IGL02603:Hipk1 APN 3 103750272 missense probably damaging 0.97
IGL02632:Hipk1 APN 3 103760545 missense probably benign 0.14
IGL02686:Hipk1 APN 3 103778017 missense possibly damaging 0.82
IGL03293:Hipk1 APN 3 103777259 missense possibly damaging 0.83
effluvient UTSW 3 103754325 splice site probably null
R0012:Hipk1 UTSW 3 103763680 missense probably damaging 0.98
R0012:Hipk1 UTSW 3 103763680 missense probably damaging 0.98
R0512:Hipk1 UTSW 3 103760574 missense possibly damaging 0.95
R0741:Hipk1 UTSW 3 103746812 missense probably benign 0.17
R0785:Hipk1 UTSW 3 103754325 splice site probably null
R0786:Hipk1 UTSW 3 103744304 missense probably benign
R0833:Hipk1 UTSW 3 103754296 missense probably damaging 0.98
R0836:Hipk1 UTSW 3 103754296 missense probably damaging 0.98
R1165:Hipk1 UTSW 3 103761524 missense possibly damaging 0.62
R1322:Hipk1 UTSW 3 103743981 missense probably damaging 1.00
R1521:Hipk1 UTSW 3 103777782 missense probably benign 0.16
R1543:Hipk1 UTSW 3 103778164 missense probably benign 0.00
R2085:Hipk1 UTSW 3 103750354 missense probably benign 0.00
R2158:Hipk1 UTSW 3 103760538 missense probably damaging 1.00
R2291:Hipk1 UTSW 3 103761610 missense probably damaging 1.00
R3522:Hipk1 UTSW 3 103744114 missense probably damaging 0.96
R4516:Hipk1 UTSW 3 103750372 missense probably damaging 0.98
R4518:Hipk1 UTSW 3 103750372 missense probably damaging 0.98
R4884:Hipk1 UTSW 3 103744022 missense possibly damaging 0.47
R5023:Hipk1 UTSW 3 103777507 missense probably damaging 1.00
R6045:Hipk1 UTSW 3 103746902 missense probably benign 0.45
R6641:Hipk1 UTSW 3 103753405 missense probably damaging 0.99
R6904:Hipk1 UTSW 3 103777512 missense possibly damaging 0.90
R6925:Hipk1 UTSW 3 103778245 missense unknown
Z1088:Hipk1 UTSW 3 103764544 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CCTGCTGGGCAACTCCAGGAA -3'
(R):5'- AGTCGTCCTTTGACATCATTTGCACAT -3'

Sequencing Primer
(F):5'- GCAACTCCAGGAACTGGC -3'
(R):5'- GCACAGACAAACCCTGTATGGA -3'
Posted On2014-03-17