Incidental Mutation 'R1384:Ica1'
ID163160
Institutional Source Beutler Lab
Gene Symbol Ica1
Ensembl Gene ENSMUSG00000062995
Gene Nameislet cell autoantigen 1
SynonymsICA69, 69kDa
MMRRC Submission 039446-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.200) question?
Stock #R1384 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location8630527-8778488 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 8742262 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 124 (Q124*)
Ref Sequence ENSEMBL: ENSMUSP00000138459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038403] [ENSMUST00000115518] [ENSMUST00000115519] [ENSMUST00000115520] [ENSMUST00000153390] [ENSMUST00000156695]
Predicted Effect probably null
Transcript: ENSMUST00000038403
AA Change: Q124*
SMART Domains Protein: ENSMUSP00000040062
Gene: ENSMUSG00000062995
AA Change: Q124*

DomainStartEndE-ValueType
Arfaptin 21 248 1.54e-125 SMART
ICA69 260 478 1.25e-93 SMART
Predicted Effect probably null
Transcript: ENSMUST00000115518
AA Change: Q124*
SMART Domains Protein: ENSMUSP00000111180
Gene: ENSMUSG00000062995
AA Change: Q124*

DomainStartEndE-ValueType
Arfaptin 21 248 1.54e-125 SMART
Predicted Effect probably null
Transcript: ENSMUST00000115519
AA Change: Q124*
SMART Domains Protein: ENSMUSP00000111181
Gene: ENSMUSG00000062995
AA Change: Q124*

DomainStartEndE-ValueType
Arfaptin 21 248 1.54e-125 SMART
ICA69 260 465 4.01e-83 SMART
Predicted Effect probably null
Transcript: ENSMUST00000115520
AA Change: Q124*
SMART Domains Protein: ENSMUSP00000111182
Gene: ENSMUSG00000062995
AA Change: Q124*

DomainStartEndE-ValueType
Arfaptin 21 248 1.54e-125 SMART
ICA69 260 478 1.25e-93 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135113
Predicted Effect probably null
Transcript: ENSMUST00000153390
AA Change: Q124*
SMART Domains Protein: ENSMUSP00000117734
Gene: ENSMUSG00000062995
AA Change: Q124*

DomainStartEndE-ValueType
Arfaptin 21 248 1.54e-125 SMART
Predicted Effect probably null
Transcript: ENSMUST00000156695
AA Change: Q124*
SMART Domains Protein: ENSMUSP00000138459
Gene: ENSMUSG00000062995
AA Change: Q124*

DomainStartEndE-ValueType
Arfaptin 21 248 1.54e-125 SMART
Pfam:ICA69 260 301 4.1e-12 PFAM
Meta Mutation Damage Score 0.57 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.1%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with an arfaptin homology domain that is found both in the cytosol and as membrane-bound form on the Golgi complex and immature secretory granules. This protein is believed to be an autoantigen in insulin-dependent diabetes mellitus and primary Sjogren's syndrome. Several transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Feb 2013]
PHENOTYPE: Homozygous mutation of this gene results in diabetes and spontaneous lethality at 4-5 months of age on a NOD background, however mice on a 129/Sv background are normal. Onset of diabetes starts 4 weeks later than wild-type NOD mice and mutants are resistant to cyclophospamide-accelerated diabetes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930408O17Rik G A 12: 104,871,192 noncoding transcript Het
A930033H14Rik A G 10: 69,212,361 probably benign Het
Abcf3 G A 16: 20,559,303 G522R probably damaging Het
Abi3bp A G 16: 56,574,499 Y190C probably damaging Het
Alg10b A G 15: 90,227,582 K210E possibly damaging Het
Amph G A 13: 19,142,028 V643M probably damaging Het
C9 G A 15: 6,458,934 V90I probably benign Het
Cacna1s A G 1: 136,094,971 I634V probably benign Het
Catip A G 1: 74,364,363 D153G probably benign Het
Cpt1c G A 7: 44,960,924 probably benign Het
Cyp2c23 A G 19: 44,013,663 S296P probably damaging Het
Cyp2d41-ps G A 15: 82,779,517 noncoding transcript Het
Edc4 T A 8: 105,892,382 I1327N probably damaging Het
Fbxl18 G A 5: 142,886,223 A419V probably damaging Het
Filip1l A G 16: 57,571,289 K509E possibly damaging Het
Golga4 A G 9: 118,565,651 E96G probably damaging Het
Grid2ip T G 5: 143,386,096 probably null Het
Gucy1a2 A C 9: 3,759,620 E475D probably damaging Het
Hipk1 A G 3: 103,758,774 probably benign Het
Igsf3 T C 3: 101,451,296 probably null Het
Matn2 A G 15: 34,409,810 E462G probably benign Het
Men1 T C 19: 6,339,891 S464P probably benign Het
Mrgpra2b T A 7: 47,463,994 E330V probably damaging Het
Myoz2 A T 3: 123,026,116 S65T probably damaging Het
Nckap1 A G 2: 80,533,670 M492T possibly damaging Het
Nhsl1 A T 10: 18,408,513 K67N probably null Het
Nostrin A G 2: 69,189,062 R484G probably benign Het
Olfr936 T A 9: 39,046,904 I172F possibly damaging Het
Otog T A 7: 46,273,695 probably benign Het
P2rx5 A G 11: 73,167,890 Y300C probably damaging Het
Pars2 T C 4: 106,653,716 F232L possibly damaging Het
Pi4ka A G 16: 17,297,537 probably benign Het
Pld3 A G 7: 27,537,657 S266P probably benign Het
Pole G A 5: 110,323,664 V1425M possibly damaging Het
Prss43 A G 9: 110,827,442 I66V probably benign Het
Rtn4 A T 11: 29,736,437 N264I probably damaging Het
Slc45a2 A G 15: 11,025,746 Y394C probably benign Het
Speer4f2 A T 5: 17,374,449 N82I probably damaging Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Strip1 T C 3: 107,626,839 S160G probably benign Het
Tbx2 A G 11: 85,833,492 K129R probably benign Het
Tfr2 T C 5: 137,586,820 probably benign Het
Thap12 T C 7: 98,703,438 S17P probably damaging Het
Timm21 G C 18: 84,949,262 L130V probably damaging Het
Tspear T C 10: 77,866,332 F200L probably benign Het
Tspyl5 T A 15: 33,687,380 R140W possibly damaging Het
Ttn T C 2: 76,775,658 D18236G probably damaging Het
Upf2 G A 2: 5,960,989 R140Q unknown Het
Vps4a T A 8: 107,036,644 I10N possibly damaging Het
Other mutations in Ica1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Ica1 APN 6 8653514 missense probably benign
IGL02248:Ica1 APN 6 8758387 utr 5 prime probably benign
IGL02547:Ica1 APN 6 8670691 splice site probably null
round_heels UTSW 6 8630799 critical splice acceptor site probably null
R0099:Ica1 UTSW 6 8749778 splice site probably benign
R0244:Ica1 UTSW 6 8653632 nonsense probably null
R0479:Ica1 UTSW 6 8754627 missense probably damaging 1.00
R0479:Ica1 UTSW 6 8754683 missense probably damaging 1.00
R0628:Ica1 UTSW 6 8644256 splice site probably benign
R0826:Ica1 UTSW 6 8667375 intron probably benign
R1186:Ica1 UTSW 6 8672326 missense probably damaging 1.00
R1957:Ica1 UTSW 6 8749736 missense possibly damaging 0.85
R2431:Ica1 UTSW 6 8658265 missense probably benign
R3722:Ica1 UTSW 6 8659021 intron probably benign
R4224:Ica1 UTSW 6 8659960 missense probably benign 0.11
R4777:Ica1 UTSW 6 8644145 missense probably benign
R5633:Ica1 UTSW 6 8667257 missense possibly damaging 0.73
R5786:Ica1 UTSW 6 8672391 missense possibly damaging 0.50
R6033:Ica1 UTSW 6 8630799 critical splice acceptor site probably null
R6033:Ica1 UTSW 6 8630799 critical splice acceptor site probably null
R6053:Ica1 UTSW 6 8630783 missense probably benign 0.01
R6221:Ica1 UTSW 6 8644181 missense possibly damaging 0.82
R6794:Ica1 UTSW 6 8653659 missense probably benign 0.00
R6819:Ica1 UTSW 6 8742288 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCTGCTCTCTATATCCGAGGGAAG -3'
(R):5'- GATTACAGGGCACCAACTCACTGAC -3'

Sequencing Primer
(F):5'- TCTATATCCGAGGGAAGTGGGG -3'
(R):5'- CAACTCACTGACAGATGTGTTCG -3'
Posted On2014-03-17