Incidental Mutation 'R1384:Slc45a2'
ID163181
Institutional Source Beutler Lab
Gene Symbol Slc45a2
Ensembl Gene ENSMUSG00000022243
Gene Namesolute carrier family 45, member 2
Synonymsblanc-sale, Oca4, dominant brown, Dbr, bls, Aim1, Aim-1, Matp
MMRRC Submission 039446-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #R1384 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location11000721-11029233 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 11025746 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 394 (Y394C)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117100]
Predicted Effect probably benign
Transcript: ENSMUST00000022851
AA Change: Y394C

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000022851
Gene: ENSMUSG00000022243
AA Change: Y394C

DomainStartEndE-ValueType
Pfam:MFS_2 34 262 2.4e-17 PFAM
Pfam:MFS_1 36 363 3e-13 PFAM
transmembrane domain 365 387 N/A INTRINSIC
transmembrane domain 394 416 N/A INTRINSIC
transmembrane domain 421 443 N/A INTRINSIC
transmembrane domain 477 499 N/A INTRINSIC
transmembrane domain 504 526 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117100
AA Change: Y394C

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000112408
Gene: ENSMUSG00000022243
AA Change: Y394C

DomainStartEndE-ValueType
Pfam:MFS_2 1 457 2e-22 PFAM
Pfam:MFS_1 2 292 2.6e-12 PFAM
Meta Mutation Damage Score 0.042 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.1%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transporter protein that mediates melanin synthesis. The protein is expressed in a high percentage of melanoma cell lines. Mutations in this gene are a cause of oculocutaneous albinism type 4, and polymorphisms in this gene are associated with variations in skin and hair color. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygotes for spontaneous mutations exhibit varied degrees of hypopigmentation of the eyes, skin, and hair, especially the underfur. Eyes are very light at birth but darken with age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930408O17Rik G A 12: 104,871,192 noncoding transcript Het
A930033H14Rik A G 10: 69,212,361 probably benign Het
Abcf3 G A 16: 20,559,303 G522R probably damaging Het
Abi3bp A G 16: 56,574,499 Y190C probably damaging Het
Alg10b A G 15: 90,227,582 K210E possibly damaging Het
Amph G A 13: 19,142,028 V643M probably damaging Het
C9 G A 15: 6,458,934 V90I probably benign Het
Cacna1s A G 1: 136,094,971 I634V probably benign Het
Catip A G 1: 74,364,363 D153G probably benign Het
Cpt1c G A 7: 44,960,924 probably benign Het
Cyp2c23 A G 19: 44,013,663 S296P probably damaging Het
Cyp2d41-ps G A 15: 82,779,517 noncoding transcript Het
Edc4 T A 8: 105,892,382 I1327N probably damaging Het
Fbxl18 G A 5: 142,886,223 A419V probably damaging Het
Filip1l A G 16: 57,571,289 K509E possibly damaging Het
Golga4 A G 9: 118,565,651 E96G probably damaging Het
Grid2ip T G 5: 143,386,096 probably null Het
Gucy1a2 A C 9: 3,759,620 E475D probably damaging Het
Hipk1 A G 3: 103,758,774 probably benign Het
Ica1 G A 6: 8,742,262 Q124* probably null Het
Igsf3 T C 3: 101,451,296 probably null Het
Matn2 A G 15: 34,409,810 E462G probably benign Het
Men1 T C 19: 6,339,891 S464P probably benign Het
Mrgpra2b T A 7: 47,463,994 E330V probably damaging Het
Myoz2 A T 3: 123,026,116 S65T probably damaging Het
Nckap1 A G 2: 80,533,670 M492T possibly damaging Het
Nhsl1 A T 10: 18,408,513 K67N probably null Het
Nostrin A G 2: 69,189,062 R484G probably benign Het
Olfr936 T A 9: 39,046,904 I172F possibly damaging Het
Otog T A 7: 46,273,695 probably benign Het
P2rx5 A G 11: 73,167,890 Y300C probably damaging Het
Pars2 T C 4: 106,653,716 F232L possibly damaging Het
Pi4ka A G 16: 17,297,537 probably benign Het
Pld3 A G 7: 27,537,657 S266P probably benign Het
Pole G A 5: 110,323,664 V1425M possibly damaging Het
Prss43 A G 9: 110,827,442 I66V probably benign Het
Rtn4 A T 11: 29,736,437 N264I probably damaging Het
Speer4f2 A T 5: 17,374,449 N82I probably damaging Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Strip1 T C 3: 107,626,839 S160G probably benign Het
Tbx2 A G 11: 85,833,492 K129R probably benign Het
Tfr2 T C 5: 137,586,820 probably benign Het
Thap12 T C 7: 98,703,438 S17P probably damaging Het
Timm21 G C 18: 84,949,262 L130V probably damaging Het
Tspear T C 10: 77,866,332 F200L probably benign Het
Tspyl5 T A 15: 33,687,380 R140W possibly damaging Het
Ttn T C 2: 76,775,658 D18236G probably damaging Het
Upf2 G A 2: 5,960,989 R140Q unknown Het
Vps4a T A 8: 107,036,644 I10N possibly damaging Het
Other mutations in Slc45a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02074:Slc45a2 APN 15 11000817 start codon destroyed probably null 0.80
IGL02283:Slc45a2 APN 15 11001182 missense probably damaging 1.00
IGL02634:Slc45a2 APN 15 11023354 missense probably benign 0.21
IGL03039:Slc45a2 APN 15 11012687 missense probably benign
IGL03123:Slc45a2 APN 15 11012655 missense probably benign 0.01
IGL03226:Slc45a2 APN 15 11022192 missense probably damaging 1.00
cardigan UTSW 15 11022172 synonymous probably benign
cheng UTSW 15 11025868 missense probably damaging 0.99
Draco2 UTSW 15 11000817 start codon destroyed probably benign 0.05
galak UTSW 15 11012667 missense probably benign
goku UTSW 15 11000855 nonsense probably null
grey_goose UTSW 15 11002981 missense probably damaging 1.00
june_gloom UTSW 15 11023443 missense possibly damaging 0.94
nilla UTSW 15 splice donor site
Olaf UTSW 15 unclassified
sweater UTSW 15 11012610 missense probably damaging 1.00
voldemort UTSW 15 unclassified
yuki UTSW 15 11001092 missense probably damaging 1.00
zuckerkuss UTSW 15 11025935 critical splice donor site probably benign
R0148:Slc45a2 UTSW 15 11025868 missense probably damaging 0.99
R0433:Slc45a2 UTSW 15 11025745 missense probably benign 0.17
R0440:Slc45a2 UTSW 15 11000817 start codon destroyed probably benign 0.05
R0675:Slc45a2 UTSW 15 11025778 missense probably damaging 1.00
R1616:Slc45a2 UTSW 15 11022128 missense probably null 0.01
R1824:Slc45a2 UTSW 15 11022086 missense probably damaging 0.99
R2244:Slc45a2 UTSW 15 11003001 missense probably benign 0.21
R3761:Slc45a2 UTSW 15 11012714 missense probably benign 0.07
R4631:Slc45a2 UTSW 15 11012576 missense probably benign 0.13
R4756:Slc45a2 UTSW 15 11027930 nonsense probably null
R4990:Slc45a2 UTSW 15 11001150 missense probably benign 0.00
R5066:Slc45a2 UTSW 15 11012607 missense probably benign 0.31
R5209:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5210:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5211:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5212:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5213:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5259:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5261:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5390:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5394:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5395:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5422:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5496:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5498:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5499:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5500:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5501:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5649:Slc45a2 UTSW 15 11012607 missense probably benign 0.00
R5662:Slc45a2 UTSW 15 11022083 missense probably benign 0.31
R5696:Slc45a2 UTSW 15 11001133 missense probably damaging 1.00
R5896:Slc45a2 UTSW 15 11000855 nonsense probably null
R6236:Slc45a2 UTSW 15 11022072 missense probably benign 0.00
R6709:Slc45a2 UTSW 15 11001130 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- ACAGTAGAGTCAGCAAGGCAACTTC -3'
(R):5'- CTCTTCACGGTGGTACTCAGCAATG -3'

Sequencing Primer
(F):5'- GCTGTTTCTGGCACACAGATAAG -3'
(R):5'- TGGTACTCAGCAATGAGGTTAAAG -3'
Posted On2014-03-17