Incidental Mutation 'R1384:Abi3bp'
ID163188
Institutional Source Beutler Lab
Gene Symbol Abi3bp
Ensembl Gene ENSMUSG00000035258
Gene NameABI gene family, member 3 (NESH) binding protein
SynonymsD930038M13Rik, eratin, TARSH, 5033411B22Rik
MMRRC Submission 039446-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R1384 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location56477878-56690135 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 56574499 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 190 (Y190C)
Ref Sequence ENSEMBL: ENSMUSP00000156180 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048471] [ENSMUST00000096012] [ENSMUST00000096013] [ENSMUST00000171000] [ENSMUST00000231781] [ENSMUST00000231832] [ENSMUST00000231870]
Predicted Effect probably damaging
Transcript: ENSMUST00000048471
AA Change: Y190C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000036257
Gene: ENSMUSG00000035258
AA Change: Y190C

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FN3 114 203 3.08e-2 SMART
low complexity region 433 446 N/A INTRINSIC
low complexity region 516 528 N/A INTRINSIC
low complexity region 579 591 N/A INTRINSIC
low complexity region 734 747 N/A INTRINSIC
low complexity region 751 764 N/A INTRINSIC
FN3 941 1024 6.29e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000096012
AA Change: Y190C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093711
Gene: ENSMUSG00000035258
AA Change: Y190C

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FN3 114 203 3.08e-2 SMART
low complexity region 433 446 N/A INTRINSIC
low complexity region 634 647 N/A INTRINSIC
low complexity region 651 664 N/A INTRINSIC
FN3 841 924 6.29e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000096013
AA Change: Y190C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093712
Gene: ENSMUSG00000035258
AA Change: Y190C

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FN3 114 203 3.08e-2 SMART
low complexity region 433 446 N/A INTRINSIC
low complexity region 670 683 N/A INTRINSIC
low complexity region 687 700 N/A INTRINSIC
FN3 877 960 6.29e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171000
AA Change: Y190C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128818
Gene: ENSMUSG00000035258
AA Change: Y190C

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FN3 114 203 3.08e-2 SMART
low complexity region 464 477 N/A INTRINSIC
low complexity region 481 494 N/A INTRINSIC
FN3 671 754 6.29e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231337
Predicted Effect probably damaging
Transcript: ENSMUST00000231781
AA Change: Y190C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000231832
AA Change: Y190C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000231870
AA Change: Y190C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.288 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.1%
Validation Efficiency 96% (54/56)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930408O17Rik G A 12: 104,871,192 noncoding transcript Het
A930033H14Rik A G 10: 69,212,361 probably benign Het
Abcf3 G A 16: 20,559,303 G522R probably damaging Het
Alg10b A G 15: 90,227,582 K210E possibly damaging Het
Amph G A 13: 19,142,028 V643M probably damaging Het
C9 G A 15: 6,458,934 V90I probably benign Het
Cacna1s A G 1: 136,094,971 I634V probably benign Het
Catip A G 1: 74,364,363 D153G probably benign Het
Cpt1c G A 7: 44,960,924 probably benign Het
Cyp2c23 A G 19: 44,013,663 S296P probably damaging Het
Cyp2d41-ps G A 15: 82,779,517 noncoding transcript Het
Edc4 T A 8: 105,892,382 I1327N probably damaging Het
Fbxl18 G A 5: 142,886,223 A419V probably damaging Het
Filip1l A G 16: 57,571,289 K509E possibly damaging Het
Golga4 A G 9: 118,565,651 E96G probably damaging Het
Grid2ip T G 5: 143,386,096 probably null Het
Gucy1a2 A C 9: 3,759,620 E475D probably damaging Het
Hipk1 A G 3: 103,758,774 probably benign Het
Ica1 G A 6: 8,742,262 Q124* probably null Het
Igsf3 T C 3: 101,451,296 probably null Het
Matn2 A G 15: 34,409,810 E462G probably benign Het
Men1 T C 19: 6,339,891 S464P probably benign Het
Mrgpra2b T A 7: 47,463,994 E330V probably damaging Het
Myoz2 A T 3: 123,026,116 S65T probably damaging Het
Nckap1 A G 2: 80,533,670 M492T possibly damaging Het
Nhsl1 A T 10: 18,408,513 K67N probably null Het
Nostrin A G 2: 69,189,062 R484G probably benign Het
Olfr936 T A 9: 39,046,904 I172F possibly damaging Het
Otog T A 7: 46,273,695 probably benign Het
P2rx5 A G 11: 73,167,890 Y300C probably damaging Het
Pars2 T C 4: 106,653,716 F232L possibly damaging Het
Pi4ka A G 16: 17,297,537 probably benign Het
Pld3 A G 7: 27,537,657 S266P probably benign Het
Pole G A 5: 110,323,664 V1425M possibly damaging Het
Prss43 A G 9: 110,827,442 I66V probably benign Het
Rtn4 A T 11: 29,736,437 N264I probably damaging Het
Slc45a2 A G 15: 11,025,746 Y394C probably benign Het
Speer4f2 A T 5: 17,374,449 N82I probably damaging Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Strip1 T C 3: 107,626,839 S160G probably benign Het
Tbx2 A G 11: 85,833,492 K129R probably benign Het
Tfr2 T C 5: 137,586,820 probably benign Het
Thap12 T C 7: 98,703,438 S17P probably damaging Het
Timm21 G C 18: 84,949,262 L130V probably damaging Het
Tspear T C 10: 77,866,332 F200L probably benign Het
Tspyl5 T A 15: 33,687,380 R140W possibly damaging Het
Ttn T C 2: 76,775,658 D18236G probably damaging Het
Upf2 G A 2: 5,960,989 R140Q unknown Het
Vps4a T A 8: 107,036,644 I10N possibly damaging Het
Other mutations in Abi3bp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Abi3bp APN 16 56602805 missense probably null 0.99
IGL01580:Abi3bp APN 16 56675210 missense probably damaging 1.00
IGL01633:Abi3bp APN 16 56677800 missense probably damaging 1.00
IGL01783:Abi3bp APN 16 56532969 critical splice donor site probably null
IGL01866:Abi3bp APN 16 56671973 missense probably benign 0.19
IGL02022:Abi3bp APN 16 56592636 missense probably damaging 1.00
IGL02086:Abi3bp APN 16 56642567 splice site probably benign
IGL02122:Abi3bp APN 16 56687128 splice site probably benign
IGL02155:Abi3bp APN 16 56587964 missense probably damaging 0.99
IGL02351:Abi3bp APN 16 56654055 missense possibly damaging 0.91
IGL02358:Abi3bp APN 16 56654055 missense possibly damaging 0.91
IGL02418:Abi3bp APN 16 56604116 splice site probably benign
IGL02559:Abi3bp APN 16 56687070 nonsense probably null
IGL02617:Abi3bp APN 16 56574444 nonsense probably null
IGL02810:Abi3bp APN 16 56677775 missense probably damaging 1.00
IGL03057:Abi3bp APN 16 56668391 missense possibly damaging 0.95
IGL03174:Abi3bp APN 16 56614747 missense possibly damaging 0.64
R0389:Abi3bp UTSW 16 56671307 missense possibly damaging 0.79
R0485:Abi3bp UTSW 16 56604012 intron probably null
R0557:Abi3bp UTSW 16 56668387 missense probably damaging 0.97
R0616:Abi3bp UTSW 16 56654070 missense probably damaging 0.99
R0685:Abi3bp UTSW 16 56532953 missense possibly damaging 0.90
R0783:Abi3bp UTSW 16 56595238 critical splice acceptor site probably null
R0828:Abi3bp UTSW 16 56677830 missense probably damaging 1.00
R0841:Abi3bp UTSW 16 56668276 missense possibly damaging 0.95
R1078:Abi3bp UTSW 16 56654081 critical splice donor site probably null
R1101:Abi3bp UTSW 16 56606158 missense probably damaging 1.00
R1116:Abi3bp UTSW 16 56686429 splice site probably benign
R1145:Abi3bp UTSW 16 56668276 missense possibly damaging 0.95
R1145:Abi3bp UTSW 16 56668276 missense possibly damaging 0.95
R1317:Abi3bp UTSW 16 56668309 missense possibly damaging 0.79
R1460:Abi3bp UTSW 16 56562417 missense probably damaging 0.99
R1730:Abi3bp UTSW 16 56668279 missense possibly damaging 0.62
R1761:Abi3bp UTSW 16 56668309 missense possibly damaging 0.79
R1830:Abi3bp UTSW 16 56587985 missense probably damaging 1.00
R1873:Abi3bp UTSW 16 56574499 missense probably damaging 1.00
R1875:Abi3bp UTSW 16 56574499 missense probably damaging 1.00
R1996:Abi3bp UTSW 16 56671357 missense possibly damaging 0.61
R2018:Abi3bp UTSW 16 56677796 missense probably damaging 1.00
R2019:Abi3bp UTSW 16 56677796 missense probably damaging 1.00
R2035:Abi3bp UTSW 16 56660218 missense probably benign 0.21
R2118:Abi3bp UTSW 16 56477864 unclassified probably benign
R2202:Abi3bp UTSW 16 56613203 missense probably benign 0.06
R2202:Abi3bp UTSW 16 56650725 nonsense probably null
R2203:Abi3bp UTSW 16 56613203 missense probably benign 0.06
R3030:Abi3bp UTSW 16 56657319 missense possibly damaging 0.79
R3952:Abi3bp UTSW 16 56604038 missense possibly damaging 0.88
R4176:Abi3bp UTSW 16 56652200 missense probably damaging 0.96
R4296:Abi3bp UTSW 16 56668310 missense probably benign 0.05
R4301:Abi3bp UTSW 16 56556903 missense probably damaging 1.00
R4354:Abi3bp UTSW 16 56532951 missense probably benign 0.05
R4417:Abi3bp UTSW 16 56654035 missense probably damaging 1.00
R4716:Abi3bp UTSW 16 56650725 nonsense probably null
R4808:Abi3bp UTSW 16 56594516 missense probably damaging 0.96
R4814:Abi3bp UTSW 16 56650753 missense probably benign 0.06
R5016:Abi3bp UTSW 16 56671268 missense probably damaging 0.97
R5290:Abi3bp UTSW 16 56642475 splice site probably null
R5891:Abi3bp UTSW 16 56606133 missense probably damaging 1.00
R5897:Abi3bp UTSW 16 56604669 missense possibly damaging 0.53
R6146:Abi3bp UTSW 16 56671265 missense probably damaging 0.99
R6267:Abi3bp UTSW 16 56594497 missense probably damaging 0.97
R6905:Abi3bp UTSW 16 56574517 missense probably damaging 1.00
R6908:Abi3bp UTSW 16 56657305 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCACCCAATCATGCTGCTACATGAC -3'
(R):5'- GCTAGTGAAACCATTTAAGCCAGACCC -3'

Sequencing Primer
(F):5'- tccacaagcacctgtaatcc -3'
(R):5'- TTAAGCCAGACCCCCCCC -3'
Posted On2014-03-17