Incidental Mutation 'R1385:Prkcq'
ID163195
Institutional Source Beutler Lab
Gene Symbol Prkcq
Ensembl Gene ENSMUSG00000026778
Gene Nameprotein kinase C, theta
SynonymsPKC theta, PKC-0, PKCtheta, PKC-theta, A130035A12Rik, Pkcq
MMRRC Submission 039447-MU
Accession Numbers

Genbank: NM_008859; MGI: 97601

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1385 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location11172108-11301222 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 11256286 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 383 (H383R)
Ref Sequence ENSEMBL: ENSMUSP00000028118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028118] [ENSMUST00000102970]
PDB Structure
Identification of the Activator Binding Residues in the Second Cysteine-Rich Regulatory Domain of Protein Kinase C Theta [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000028118
AA Change: H383R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028118
Gene: ENSMUSG00000026778
AA Change: H383R

DomainStartEndE-ValueType
PDB:2ENJ|A 3 126 6e-83 PDB
C1 160 209 3.27e-15 SMART
C1 232 281 2.22e-17 SMART
S_TKc 380 634 1.17e-97 SMART
S_TK_X 635 698 2.6e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102970
AA Change: H383R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000100035
Gene: ENSMUSG00000026778
AA Change: H383R

DomainStartEndE-ValueType
PDB:2ENJ|A 3 126 2e-84 PDB
C1 160 209 3.27e-15 SMART
C1 232 281 2.22e-17 SMART
Pfam:Pkinase_Tyr 380 558 2.8e-27 PFAM
Pfam:Pkinase 380 560 2.2e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114853
SMART Domains Protein: ENSMUSP00000110503
Gene: ENSMUSG00000026778

DomainStartEndE-ValueType
PDB:2ENJ|A 3 126 9e-86 PDB
Blast:C2 6 101 2e-44 BLAST
C1 160 209 3.27e-15 SMART
C1 232 281 2.22e-17 SMART
Pfam:Pkinase 380 465 1.7e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192461
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195207
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195628
Meta Mutation Damage Score 0.108 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role. The protein encoded by this gene is one of the PKC family members. It is a calcium-independent and phospholipid-dependent protein kinase. This kinase is important for T-cell activation. It is required for the activation of the transcription factors NF-kappaB and AP-1, and may link the T cell receptor (TCR) signaling complex to the activation of the transcription factors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit reduced T cell proliferative responses and interleukin 2 production and a lack of T cell receptor-initiated NF-kappaB activation in mature T lymphocytes. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(2) Targeted, other(1)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030419C18Rik AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG 9: 58,499,432 probably benign Het
Aldh7a1 A G 18: 56,542,285 S269P probably damaging Het
Arf3 A G 15: 98,742,613 V43A probably damaging Het
Arhgap1 C A 2: 91,670,831 N457K probably damaging Het
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Ccdc39 C T 3: 33,821,412 E544K probably damaging Het
Cfap44 A G 16: 44,470,775 E1546G probably damaging Het
Cntn6 A G 6: 104,861,900 I900V probably benign Het
Edem1 A G 6: 108,846,684 N347S probably damaging Het
Erich6 A G 3: 58,636,830 I112T probably benign Het
Gemin2 A G 12: 59,018,146 probably null Het
Gm44 T A X: 90,892,268 C43S probably benign Het
Hunk T A 16: 90,472,486 V306E possibly damaging Het
Hydin A G 8: 110,523,204 I2260V probably benign Het
Itgbl1 A G 14: 123,661,511 probably null Het
Iws1 T A 18: 32,090,430 N630K probably benign Het
Lama2 C A 10: 27,224,043 R822L probably benign Het
Lrrc56 A G 7: 141,205,525 D130G probably damaging Het
Malrd1 A T 2: 16,042,228 I1722F unknown Het
Mark4 G T 7: 19,426,027 probably null Het
Muc5b T C 7: 141,862,137 V2940A probably benign Het
Mxd1 T A 6: 86,651,567 Q62L probably damaging Het
Ncapd2 A T 6: 125,173,115 S917T probably benign Het
Nr2c2 T G 6: 92,154,470 F171C probably damaging Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Nynrin A T 14: 55,864,899 Q675L probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Ocstamp T C 2: 165,396,039 D435G probably benign Het
Pdzd2 T C 15: 12,411,022 T553A probably benign Het
Pllp A G 8: 94,679,368 Y96H probably benign Het
Polg2 A G 11: 106,768,323 S455P probably damaging Het
Ppp1r9b A G 11: 94,992,211 T222A probably benign Het
Prkcd G A 14: 30,607,405 T26I probably damaging Het
Prune2 A G 19: 17,124,948 I2490M possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Scn9a G A 2: 66,563,542 P229L probably damaging Het
Serpinb5 A G 1: 106,876,123 T180A probably damaging Het
Slc5a2 G C 7: 128,270,631 R412P probably damaging Het
Sphk2 A G 7: 45,712,291 I82T probably damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Treml1 T G 17: 48,360,198 V37G probably damaging Het
Trim33 A G 3: 103,310,950 K272E possibly damaging Het
Trpv6 T C 6: 41,621,129 D748G probably benign Het
Ubr4 A G 4: 139,402,612 H681R probably benign Het
Uhrf1bp1l A G 10: 89,790,641 N399S possibly damaging Het
Vmn2r82 A T 10: 79,396,491 R775* probably null Het
Xpo1 T C 11: 23,261,863 L8S probably damaging Het
Zfand4 G A 6: 116,273,638 G10R probably damaging Het
Zfp119a T A 17: 55,865,826 H339L probably damaging Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Other mutations in Prkcq
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01654:Prkcq APN 2 11283843 missense probably damaging 1.00
IGL01656:Prkcq APN 2 11226955 missense probably damaging 1.00
IGL01732:Prkcq APN 2 11260833 splice site probably benign
IGL02136:Prkcq APN 2 11260668 missense probably benign 0.00
IGL02161:Prkcq APN 2 11277076 missense probably benign
IGL02178:Prkcq APN 2 11277040 missense possibly damaging 0.93
IGL03107:Prkcq APN 2 11260786 missense probably damaging 1.00
IGL03149:Prkcq APN 2 11232545 missense probably benign 0.11
celina UTSW 2 11283849 missense possibly damaging 0.82
celina2 UTSW 2 11226986 critical splice donor site probably null
3-1:Prkcq UTSW 2 11300094 missense probably damaging 1.00
K3955:Prkcq UTSW 2 11246793 splice site probably benign
R0049:Prkcq UTSW 2 11283832 missense probably benign 0.04
R0049:Prkcq UTSW 2 11283832 missense probably benign 0.04
R0183:Prkcq UTSW 2 11253162 missense probably damaging 1.00
R0366:Prkcq UTSW 2 11246838 splice site probably benign
R0388:Prkcq UTSW 2 11254234 missense probably benign
R1687:Prkcq UTSW 2 11290533 missense probably damaging 1.00
R1693:Prkcq UTSW 2 11254199 missense probably damaging 0.99
R1760:Prkcq UTSW 2 11300070 missense probably damaging 1.00
R1764:Prkcq UTSW 2 11232631 missense probably damaging 1.00
R1968:Prkcq UTSW 2 11245397 missense probably damaging 1.00
R2020:Prkcq UTSW 2 11279521 missense probably benign
R2108:Prkcq UTSW 2 11232569 missense probably damaging 1.00
R2762:Prkcq UTSW 2 11232640 missense possibly damaging 0.75
R3402:Prkcq UTSW 2 11283849 missense possibly damaging 0.82
R3429:Prkcq UTSW 2 11246970 missense probably damaging 1.00
R3545:Prkcq UTSW 2 11283816 missense probably benign 0.11
R3547:Prkcq UTSW 2 11283816 missense probably benign 0.11
R3893:Prkcq UTSW 2 11226971 missense probably damaging 1.00
R4086:Prkcq UTSW 2 11283868 missense probably damaging 0.97
R4423:Prkcq UTSW 2 11256169 missense possibly damaging 0.66
R4541:Prkcq UTSW 2 11283812 missense possibly damaging 0.84
R4649:Prkcq UTSW 2 11279522 missense possibly damaging 0.83
R4652:Prkcq UTSW 2 11279522 missense possibly damaging 0.83
R4820:Prkcq UTSW 2 11226986 critical splice donor site probably null
R5197:Prkcq UTSW 2 11299416 missense probably damaging 1.00
R6008:Prkcq UTSW 2 11256286 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCAGGTTTACAGACAGATGCAG -3'
(R):5'- GATTTGGGGCCAAAGATCCATAGGG -3'

Sequencing Primer
(F):5'- CTAAGTGCCTACAGTGAGTGACC -3'
(R):5'- GGAACAGAGACTGCTATTACTGC -3'
Posted On2014-03-17