Incidental Mutation 'R1385:Itgbl1'
ID163234
Institutional Source Beutler Lab
Gene Symbol Itgbl1
Ensembl Gene ENSMUSG00000032925
Gene Nameintegrin, beta-like 1
SynonymsB930011D01Rik, with EGF-like repeat domains
MMRRC Submission 039447-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R1385 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location123659971-123975618 bp(+) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) A to G at 123661511 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115455 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049681] [ENSMUST00000132026] [ENSMUST00000142161]
Predicted Effect probably null
Transcript: ENSMUST00000049681
SMART Domains Protein: ENSMUSP00000059019
Gene: ENSMUSG00000032925

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
internal_repeat_1 62 164 7.9e-12 PROSPERO
EGF_like 184 217 6.95e1 SMART
EGF 275 311 2.25e1 SMART
low complexity region 335 348 N/A INTRINSIC
Pfam:EGF_2 368 398 3.6e-8 PFAM
low complexity region 423 438 N/A INTRINSIC
low complexity region 448 456 N/A INTRINSIC
Blast:EGF_like 457 486 4e-9 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000132026
SMART Domains Protein: ENSMUSP00000115455
Gene: ENSMUSG00000032925

DomainStartEndE-ValueType
internal_repeat_2 22 50 3.54e-8 PROSPERO
internal_repeat_1 23 87 7.45e-14 PROSPERO
low complexity region 101 126 N/A INTRINSIC
EGF 151 187 2.25e1 SMART
low complexity region 211 224 N/A INTRINSIC
Pfam:EGF_2 239 274 1.5e-7 PFAM
low complexity region 299 314 N/A INTRINSIC
low complexity region 324 332 N/A INTRINSIC
internal_repeat_2 334 362 3.54e-8 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000142161
SMART Domains Protein: ENSMUSP00000121659
Gene: ENSMUSG00000032925

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
PDB:4G1E|B 59 171 1e-17 PDB
Blast:EGF_like 90 127 5e-15 BLAST
low complexity region 178 192 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a beta integrin-related protein that is a member of the EGF-like protein family. The encoded protein contains integrin-like cysteine-rich repeats. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030419C18Rik AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG 9: 58,499,432 probably benign Het
Aldh7a1 A G 18: 56,542,285 S269P probably damaging Het
Arf3 A G 15: 98,742,613 V43A probably damaging Het
Arhgap1 C A 2: 91,670,831 N457K probably damaging Het
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Ccdc39 C T 3: 33,821,412 E544K probably damaging Het
Cfap44 A G 16: 44,470,775 E1546G probably damaging Het
Cntn6 A G 6: 104,861,900 I900V probably benign Het
Edem1 A G 6: 108,846,684 N347S probably damaging Het
Erich6 A G 3: 58,636,830 I112T probably benign Het
Gemin2 A G 12: 59,018,146 probably null Het
Gm44 T A X: 90,892,268 C43S probably benign Het
Hunk T A 16: 90,472,486 V306E possibly damaging Het
Hydin A G 8: 110,523,204 I2260V probably benign Het
Iws1 T A 18: 32,090,430 N630K probably benign Het
Lama2 C A 10: 27,224,043 R822L probably benign Het
Lrrc56 A G 7: 141,205,525 D130G probably damaging Het
Malrd1 A T 2: 16,042,228 I1722F unknown Het
Mark4 G T 7: 19,426,027 probably null Het
Muc5b T C 7: 141,862,137 V2940A probably benign Het
Mxd1 T A 6: 86,651,567 Q62L probably damaging Het
Ncapd2 A T 6: 125,173,115 S917T probably benign Het
Nr2c2 T G 6: 92,154,470 F171C probably damaging Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Nynrin A T 14: 55,864,899 Q675L probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Ocstamp T C 2: 165,396,039 D435G probably benign Het
Pdzd2 T C 15: 12,411,022 T553A probably benign Het
Pllp A G 8: 94,679,368 Y96H probably benign Het
Polg2 A G 11: 106,768,323 S455P probably damaging Het
Ppp1r9b A G 11: 94,992,211 T222A probably benign Het
Prkcd G A 14: 30,607,405 T26I probably damaging Het
Prkcq A G 2: 11,256,286 H383R probably damaging Het
Prune2 A G 19: 17,124,948 I2490M possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Scn9a G A 2: 66,563,542 P229L probably damaging Het
Serpinb5 A G 1: 106,876,123 T180A probably damaging Het
Slc5a2 G C 7: 128,270,631 R412P probably damaging Het
Sphk2 A G 7: 45,712,291 I82T probably damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Treml1 T G 17: 48,360,198 V37G probably damaging Het
Trim33 A G 3: 103,310,950 K272E possibly damaging Het
Trpv6 T C 6: 41,621,129 D748G probably benign Het
Ubr4 A G 4: 139,402,612 H681R probably benign Het
Uhrf1bp1l A G 10: 89,790,641 N399S possibly damaging Het
Vmn2r82 A T 10: 79,396,491 R775* probably null Het
Xpo1 T C 11: 23,261,863 L8S probably damaging Het
Zfand4 G A 6: 116,273,638 G10R probably damaging Het
Zfp119a T A 17: 55,865,826 H339L probably damaging Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Other mutations in Itgbl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00673:Itgbl1 APN 14 123846432 splice site probably benign
IGL01290:Itgbl1 APN 14 123966725 missense probably benign 0.02
IGL01618:Itgbl1 APN 14 123827799 missense possibly damaging 0.88
IGL02024:Itgbl1 APN 14 123857492 missense probably damaging 1.00
IGL02192:Itgbl1 APN 14 123843926 missense probably damaging 1.00
IGL02215:Itgbl1 APN 14 123972141 missense probably benign 0.01
IGL02400:Itgbl1 APN 14 123846526 missense probably damaging 1.00
IGL02483:Itgbl1 APN 14 123827743 splice site probably benign
H8441:Itgbl1 UTSW 14 123973287 missense probably damaging 1.00
R0137:Itgbl1 UTSW 14 123840686 critical splice donor site probably null
R0193:Itgbl1 UTSW 14 123846546 missense probably benign 0.09
R0355:Itgbl1 UTSW 14 123840585 nonsense probably null
R0598:Itgbl1 UTSW 14 123857436 missense possibly damaging 0.93
R0662:Itgbl1 UTSW 14 123827894 missense probably damaging 1.00
R0689:Itgbl1 UTSW 14 123827847 missense possibly damaging 0.65
R1957:Itgbl1 UTSW 14 123966678 missense probably damaging 1.00
R3739:Itgbl1 UTSW 14 123966678 missense probably damaging 1.00
R3842:Itgbl1 UTSW 14 123840565 missense possibly damaging 0.92
R4434:Itgbl1 UTSW 14 123972199 missense probably damaging 1.00
R4463:Itgbl1 UTSW 14 123840668 missense probably damaging 0.97
R4696:Itgbl1 UTSW 14 123966708 missense probably damaging 1.00
R4937:Itgbl1 UTSW 14 123973368 missense probably benign 0.12
R5087:Itgbl1 UTSW 14 123966739 missense possibly damaging 0.52
R5747:Itgbl1 UTSW 14 123972164 nonsense probably null
R6020:Itgbl1 UTSW 14 123846565 missense probably damaging 0.99
R6169:Itgbl1 UTSW 14 123660378 missense probably benign 0.17
R6758:Itgbl1 UTSW 14 123857489 missense probably benign 0.23
V1024:Itgbl1 UTSW 14 123973287 missense probably damaging 1.00
X0012:Itgbl1 UTSW 14 123661305 missense probably benign 0.01
X0017:Itgbl1 UTSW 14 123972211 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TGCTTGGCCCACAGAGAAATGAGG -3'
(R):5'- TCCATGATTAGGAGCCACAGGAGAG -3'

Sequencing Primer
(F):5'- AGTCCGAACGCAGATGTCG -3'
(R):5'- CCACAGGAGAGGCAAGTG -3'
Posted On2014-03-17