Incidental Mutation 'R1385:Cfap44'
ID163238
Institutional Source Beutler Lab
Gene Symbol Cfap44
Ensembl Gene ENSMUSG00000071550
Gene Namecilia and flagella associated protein 44
Synonyms6330444M21Rik, D16Ertd642e, Wdr52
MMRRC Submission 039447-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R1385 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location44394796-44482428 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44470775 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1546 (E1546G)
Ref Sequence ENSEMBL: ENSMUSP00000113908 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099742] [ENSMUST00000120049]
Predicted Effect probably damaging
Transcript: ENSMUST00000099742
AA Change: E1546G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097331
Gene: ENSMUSG00000071550
AA Change: E1546G

DomainStartEndE-ValueType
low complexity region 42 64 N/A INTRINSIC
low complexity region 76 92 N/A INTRINSIC
Blast:WD40 161 201 1e-7 BLAST
WD40 204 246 4.58e1 SMART
WD40 249 288 4.62e-1 SMART
Blast:WD40 292 337 2e-15 BLAST
WD40 342 381 4.8e-2 SMART
WD40 447 486 4.95e-4 SMART
WD40 491 532 2.64e2 SMART
WD40 552 591 2.98e-7 SMART
Blast:WD40 595 634 1e-19 BLAST
coiled coil region 669 711 N/A INTRINSIC
WD40 780 820 3.82e1 SMART
WD40 830 872 2.4e-2 SMART
coiled coil region 907 955 N/A INTRINSIC
coiled coil region 1101 1122 N/A INTRINSIC
low complexity region 1266 1295 N/A INTRINSIC
low complexity region 1312 1325 N/A INTRINSIC
coiled coil region 1402 1459 N/A INTRINSIC
low complexity region 1476 1488 N/A INTRINSIC
low complexity region 1489 1523 N/A INTRINSIC
coiled coil region 1543 1607 N/A INTRINSIC
coiled coil region 1630 1731 N/A INTRINSIC
coiled coil region 1795 1822 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120049
AA Change: E1546G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113908
Gene: ENSMUSG00000071550
AA Change: E1546G

DomainStartEndE-ValueType
low complexity region 42 64 N/A INTRINSIC
low complexity region 76 92 N/A INTRINSIC
Blast:WD40 161 201 1e-7 BLAST
WD40 204 246 4.58e1 SMART
WD40 249 288 4.62e-1 SMART
Blast:WD40 292 337 2e-15 BLAST
WD40 342 381 4.8e-2 SMART
WD40 447 486 4.95e-4 SMART
WD40 491 532 2.64e2 SMART
WD40 552 591 2.98e-7 SMART
Blast:WD40 595 634 1e-19 BLAST
coiled coil region 669 711 N/A INTRINSIC
WD40 780 820 3.82e1 SMART
WD40 830 872 2.4e-2 SMART
coiled coil region 907 955 N/A INTRINSIC
coiled coil region 1101 1122 N/A INTRINSIC
low complexity region 1266 1295 N/A INTRINSIC
low complexity region 1312 1325 N/A INTRINSIC
coiled coil region 1402 1459 N/A INTRINSIC
low complexity region 1476 1488 N/A INTRINSIC
low complexity region 1489 1523 N/A INTRINSIC
coiled coil region 1543 1607 N/A INTRINSIC
coiled coil region 1630 1731 N/A INTRINSIC
coiled coil region 1795 1822 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000115502
Gene: ENSMUSG00000071550
AA Change: E177G

DomainStartEndE-ValueType
coiled coil region 33 90 N/A INTRINSIC
low complexity region 108 120 N/A INTRINSIC
low complexity region 121 155 N/A INTRINSIC
coiled coil region 174 238 N/A INTRINSIC
coiled coil region 261 362 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127303
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete male sterility, asthenozoospermia, and teratozoospermia characterized by multiple sperm axonemal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030419C18Rik AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG 9: 58,499,432 probably benign Het
Aldh7a1 A G 18: 56,542,285 S269P probably damaging Het
Arf3 A G 15: 98,742,613 V43A probably damaging Het
Arhgap1 C A 2: 91,670,831 N457K probably damaging Het
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Ccdc39 C T 3: 33,821,412 E544K probably damaging Het
Cntn6 A G 6: 104,861,900 I900V probably benign Het
Edem1 A G 6: 108,846,684 N347S probably damaging Het
Erich6 A G 3: 58,636,830 I112T probably benign Het
Gemin2 A G 12: 59,018,146 probably null Het
Gm44 T A X: 90,892,268 C43S probably benign Het
Hunk T A 16: 90,472,486 V306E possibly damaging Het
Hydin A G 8: 110,523,204 I2260V probably benign Het
Itgbl1 A G 14: 123,661,511 probably null Het
Iws1 T A 18: 32,090,430 N630K probably benign Het
Lama2 C A 10: 27,224,043 R822L probably benign Het
Lrrc56 A G 7: 141,205,525 D130G probably damaging Het
Malrd1 A T 2: 16,042,228 I1722F unknown Het
Mark4 G T 7: 19,426,027 probably null Het
Muc5b T C 7: 141,862,137 V2940A probably benign Het
Mxd1 T A 6: 86,651,567 Q62L probably damaging Het
Ncapd2 A T 6: 125,173,115 S917T probably benign Het
Nr2c2 T G 6: 92,154,470 F171C probably damaging Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Nynrin A T 14: 55,864,899 Q675L probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Ocstamp T C 2: 165,396,039 D435G probably benign Het
Pdzd2 T C 15: 12,411,022 T553A probably benign Het
Pllp A G 8: 94,679,368 Y96H probably benign Het
Polg2 A G 11: 106,768,323 S455P probably damaging Het
Ppp1r9b A G 11: 94,992,211 T222A probably benign Het
Prkcd G A 14: 30,607,405 T26I probably damaging Het
Prkcq A G 2: 11,256,286 H383R probably damaging Het
Prune2 A G 19: 17,124,948 I2490M possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Scn9a G A 2: 66,563,542 P229L probably damaging Het
Serpinb5 A G 1: 106,876,123 T180A probably damaging Het
Slc5a2 G C 7: 128,270,631 R412P probably damaging Het
Sphk2 A G 7: 45,712,291 I82T probably damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Treml1 T G 17: 48,360,198 V37G probably damaging Het
Trim33 A G 3: 103,310,950 K272E possibly damaging Het
Trpv6 T C 6: 41,621,129 D748G probably benign Het
Ubr4 A G 4: 139,402,612 H681R probably benign Het
Uhrf1bp1l A G 10: 89,790,641 N399S possibly damaging Het
Vmn2r82 A T 10: 79,396,491 R775* probably null Het
Xpo1 T C 11: 23,261,863 L8S probably damaging Het
Zfand4 G A 6: 116,273,638 G10R probably damaging Het
Zfp119a T A 17: 55,865,826 H339L probably damaging Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Other mutations in Cfap44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Cfap44 APN 16 44407404 missense probably damaging 0.99
IGL00952:Cfap44 APN 16 44421275 missense probably benign 0.33
IGL01340:Cfap44 APN 16 44404130 missense probably damaging 1.00
IGL01530:Cfap44 APN 16 44449167 missense probably damaging 1.00
IGL02083:Cfap44 APN 16 44437162 missense probably damaging 1.00
IGL02088:Cfap44 APN 16 44451628 missense possibly damaging 0.59
IGL02142:Cfap44 APN 16 44421144 missense probably benign 0.15
IGL02311:Cfap44 APN 16 44404771 splice site probably benign
IGL02574:Cfap44 APN 16 44481383 missense probably damaging 1.00
IGL02893:Cfap44 APN 16 44416817 missense probably damaging 1.00
IGL02959:Cfap44 APN 16 44470867 splice site probably benign
IGL03291:Cfap44 APN 16 44407311 missense possibly damaging 0.86
feldgrau UTSW 16 44433666 nonsense probably null
I2288:Cfap44 UTSW 16 44449138 nonsense probably null
R0023:Cfap44 UTSW 16 44421220 missense probably benign 0.01
R0023:Cfap44 UTSW 16 44421220 missense probably benign 0.01
R0036:Cfap44 UTSW 16 44439069 missense possibly damaging 0.83
R0139:Cfap44 UTSW 16 44433422 missense possibly damaging 0.90
R0145:Cfap44 UTSW 16 44468372 missense probably damaging 1.00
R0193:Cfap44 UTSW 16 44449210 splice site probably null
R0238:Cfap44 UTSW 16 44422318 missense probably benign
R0238:Cfap44 UTSW 16 44422318 missense probably benign
R0288:Cfap44 UTSW 16 44415894 splice site probably benign
R0367:Cfap44 UTSW 16 44433476 critical splice donor site probably null
R0452:Cfap44 UTSW 16 44431945 missense probably benign 0.01
R0531:Cfap44 UTSW 16 44401426 start codon destroyed probably benign 0.01
R0722:Cfap44 UTSW 16 44404676 missense possibly damaging 0.94
R0801:Cfap44 UTSW 16 44422486 missense probably benign 0.41
R1209:Cfap44 UTSW 16 44422417 missense possibly damaging 0.86
R1215:Cfap44 UTSW 16 44419303 missense probably damaging 1.00
R1400:Cfap44 UTSW 16 44421212 missense probably benign 0.01
R1415:Cfap44 UTSW 16 44481389 missense probably damaging 0.99
R1475:Cfap44 UTSW 16 44433812 splice site probably benign
R1901:Cfap44 UTSW 16 44422374 missense probably benign 0.00
R1902:Cfap44 UTSW 16 44422374 missense probably benign 0.00
R1903:Cfap44 UTSW 16 44422374 missense probably benign 0.00
R2023:Cfap44 UTSW 16 44416012 missense probably benign 0.01
R2126:Cfap44 UTSW 16 44410475 missense probably benign 0.40
R2147:Cfap44 UTSW 16 44451684 missense probably benign 0.31
R2233:Cfap44 UTSW 16 44451525 missense probably benign 0.01
R2439:Cfap44 UTSW 16 44481246 unclassified probably benign
R3015:Cfap44 UTSW 16 44410469 missense probably benign 0.40
R4178:Cfap44 UTSW 16 44451853 missense possibly damaging 0.81
R4421:Cfap44 UTSW 16 44422437 missense probably damaging 1.00
R4516:Cfap44 UTSW 16 44473864 nonsense probably null
R4742:Cfap44 UTSW 16 44449252 intron probably null
R4766:Cfap44 UTSW 16 44415883 splice site probably null
R4810:Cfap44 UTSW 16 44451535 missense probably damaging 0.99
R4955:Cfap44 UTSW 16 44475277 missense possibly damaging 0.75
R5058:Cfap44 UTSW 16 44420204 splice site probably null
R5164:Cfap44 UTSW 16 44481389 missense probably damaging 0.99
R5172:Cfap44 UTSW 16 44449193 missense probably benign
R5344:Cfap44 UTSW 16 44416400 critical splice donor site probably null
R5519:Cfap44 UTSW 16 44404088 missense probably damaging 1.00
R5572:Cfap44 UTSW 16 44481305 missense possibly damaging 0.95
R5601:Cfap44 UTSW 16 44460186 missense probably damaging 1.00
R5625:Cfap44 UTSW 16 44460347 unclassified probably null
R5638:Cfap44 UTSW 16 44455531 missense possibly damaging 0.94
R5727:Cfap44 UTSW 16 44435442 missense probably damaging 0.98
R5950:Cfap44 UTSW 16 44479847 missense probably damaging 0.99
R6057:Cfap44 UTSW 16 44449097 missense probably benign 0.03
R6063:Cfap44 UTSW 16 44429892 missense probably benign 0.00
R6221:Cfap44 UTSW 16 44437186 missense probably benign 0.13
R6277:Cfap44 UTSW 16 44437306 missense probably benign 0.04
R6322:Cfap44 UTSW 16 44433666 nonsense probably null
R6836:Cfap44 UTSW 16 44404079 missense probably damaging 0.99
R6854:Cfap44 UTSW 16 44449028 critical splice acceptor site probably null
R6889:Cfap44 UTSW 16 44404132 missense probably benign 0.03
V1662:Cfap44 UTSW 16 44449138 nonsense probably null
X0060:Cfap44 UTSW 16 44449074 missense possibly damaging 0.83
Z1088:Cfap44 UTSW 16 44401466 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAATGATTTCTCCCTTGCAGAGTCTGG -3'
(R):5'- GCCACACTACGGAGCTTATGATCTAC -3'

Sequencing Primer
(F):5'- CCTTGCAGAGTCTGGTGTGG -3'
(R):5'- cccttctcctcctccctc -3'
Posted On2014-03-17