Incidental Mutation 'R1385:Zfp407'
ID163247
Institutional Source Beutler Lab
Gene Symbol Zfp407
Ensembl Gene ENSMUSG00000048410
Gene Namezinc finger protein 407
Synonyms6430585N13Rik, LOC240469, LOC381139
MMRRC Submission 039447-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.922) question?
Stock #R1385 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location84128027-84589725 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 84559773 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 1072 (A1072T)
Ref Sequence ENSEMBL: ENSMUSP00000118361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000125763]
Predicted Effect probably benign
Transcript: ENSMUST00000125450
Predicted Effect probably benign
Transcript: ENSMUST00000125763
AA Change: A1072T

PolyPhen 2 Score 0.139 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000118361
Gene: ENSMUSG00000048410
AA Change: A1072T

DomainStartEndE-ValueType
low complexity region 20 37 N/A INTRINSIC
ZnF_C2H2 178 200 8.67e-1 SMART
ZnF_U1 233 267 6.79e-1 SMART
ZnF_C2H2 236 260 4.65e-1 SMART
ZnF_C2H2 522 545 7.05e-1 SMART
ZnF_U1 548 582 1.54e1 SMART
ZnF_C2H2 551 575 1.01e-1 SMART
ZnF_C2H2 582 605 1.41e0 SMART
ZnF_U1 606 639 2.22e0 SMART
ZnF_C2H2 609 632 1.01e2 SMART
ZnF_C2H2 695 718 6.23e-2 SMART
ZnF_U1 721 755 2.96e0 SMART
ZnF_C2H2 724 748 7.11e0 SMART
ZnF_C2H2 840 863 7.55e-1 SMART
ZnF_U1 866 900 3.81e-1 SMART
ZnF_C2H2 869 893 1.07e0 SMART
ZnF_C2H2 1009 1032 6.13e-1 SMART
ZnF_U1 1035 1069 2.22e0 SMART
ZnF_C2H2 1038 1062 5.62e0 SMART
low complexity region 1223 1234 N/A INTRINSIC
ZnF_C2H2 1405 1428 5.92e0 SMART
ZnF_U1 1432 1466 2.35e0 SMART
ZnF_C2H2 1435 1459 1.76e-1 SMART
ZnF_C2H2 1477 1500 5.42e-2 SMART
ZnF_C2H2 1528 1552 1.68e1 SMART
ZnF_C2H2 1558 1580 1.43e-1 SMART
ZnF_C2H2 1586 1609 9.58e-3 SMART
ZnF_C2H2 1619 1641 2.61e-4 SMART
ZnF_C2H2 1647 1671 1.04e-3 SMART
ZnF_C2H2 1677 1699 9.44e-2 SMART
ZnF_C2H2 1705 1727 1.82e-3 SMART
ZnF_C2H2 1733 1758 4.65e-1 SMART
ZnF_C2H2 1764 1787 1.26e-2 SMART
low complexity region 1876 1887 N/A INTRINSIC
low complexity region 2017 2032 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156181
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182297
Meta Mutation Damage Score 0.0644 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger protein whose exact function is not known. It may be involved in transcriptional regulation. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030419C18Rik AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG 9: 58,499,432 probably benign Het
Aldh7a1 A G 18: 56,542,285 S269P probably damaging Het
Arf3 A G 15: 98,742,613 V43A probably damaging Het
Arhgap1 C A 2: 91,670,831 N457K probably damaging Het
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Ccdc39 C T 3: 33,821,412 E544K probably damaging Het
Cfap44 A G 16: 44,470,775 E1546G probably damaging Het
Cntn6 A G 6: 104,861,900 I900V probably benign Het
Edem1 A G 6: 108,846,684 N347S probably damaging Het
Erich6 A G 3: 58,636,830 I112T probably benign Het
Gemin2 A G 12: 59,018,146 probably null Het
Gm44 T A X: 90,892,268 C43S probably benign Het
Hunk T A 16: 90,472,486 V306E possibly damaging Het
Hydin A G 8: 110,523,204 I2260V probably benign Het
Itgbl1 A G 14: 123,661,511 probably null Het
Iws1 T A 18: 32,090,430 N630K probably benign Het
Lama2 C A 10: 27,224,043 R822L probably benign Het
Lrrc56 A G 7: 141,205,525 D130G probably damaging Het
Malrd1 A T 2: 16,042,228 I1722F unknown Het
Mark4 G T 7: 19,426,027 probably null Het
Muc5b T C 7: 141,862,137 V2940A probably benign Het
Mxd1 T A 6: 86,651,567 Q62L probably damaging Het
Ncapd2 A T 6: 125,173,115 S917T probably benign Het
Nr2c2 T G 6: 92,154,470 F171C probably damaging Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Nynrin A T 14: 55,864,899 Q675L probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Ocstamp T C 2: 165,396,039 D435G probably benign Het
Pdzd2 T C 15: 12,411,022 T553A probably benign Het
Pllp A G 8: 94,679,368 Y96H probably benign Het
Polg2 A G 11: 106,768,323 S455P probably damaging Het
Ppp1r9b A G 11: 94,992,211 T222A probably benign Het
Prkcd G A 14: 30,607,405 T26I probably damaging Het
Prkcq A G 2: 11,256,286 H383R probably damaging Het
Prune2 A G 19: 17,124,948 I2490M possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Scn9a G A 2: 66,563,542 P229L probably damaging Het
Serpinb5 A G 1: 106,876,123 T180A probably damaging Het
Slc5a2 G C 7: 128,270,631 R412P probably damaging Het
Sphk2 A G 7: 45,712,291 I82T probably damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Treml1 T G 17: 48,360,198 V37G probably damaging Het
Trim33 A G 3: 103,310,950 K272E possibly damaging Het
Trpv6 T C 6: 41,621,129 D748G probably benign Het
Ubr4 A G 4: 139,402,612 H681R probably benign Het
Uhrf1bp1l A G 10: 89,790,641 N399S possibly damaging Het
Vmn2r82 A T 10: 79,396,491 R775* probably null Het
Xpo1 T C 11: 23,261,863 L8S probably damaging Het
Zfand4 G A 6: 116,273,638 G10R probably damaging Het
Zfp119a T A 17: 55,865,826 H339L probably damaging Het
Other mutations in Zfp407
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Zfp407 APN 18 84561752 missense probably damaging 0.99
IGL02105:Zfp407 APN 18 84562720 nonsense probably null
IGL02110:Zfp407 APN 18 84559040 missense probably benign 0.00
IGL02343:Zfp407 APN 18 84209724 missense possibly damaging 0.71
IGL02456:Zfp407 APN 18 84558641 missense probably damaging 1.00
IGL02705:Zfp407 APN 18 84559031 nonsense probably null
IGL02946:Zfp407 APN 18 84560709 missense probably damaging 1.00
IGL03069:Zfp407 APN 18 84350975 missense probably damaging 1.00
IGL03145:Zfp407 APN 18 84209721 missense probably damaging 0.99
IGL03403:Zfp407 APN 18 84560797 missense probably damaging 1.00
IGL03134:Zfp407 UTSW 18 84209955 missense probably damaging 0.99
R0087:Zfp407 UTSW 18 84560411 missense probably damaging 1.00
R0243:Zfp407 UTSW 18 84558711 missense probably damaging 1.00
R0594:Zfp407 UTSW 18 84562567 missense possibly damaging 0.87
R0766:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R0787:Zfp407 UTSW 18 84209022 missense probably damaging 1.00
R0787:Zfp407 UTSW 18 84209346 missense probably benign 0.00
R1065:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1086:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1165:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1186:Zfp407 UTSW 18 84209448 missense probably benign 0.39
R1203:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1312:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1345:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1421:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1430:Zfp407 UTSW 18 84209455 missense probably benign 0.18
R1436:Zfp407 UTSW 18 84343071 splice site probably benign
R1498:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1526:Zfp407 UTSW 18 84561033 missense possibly damaging 0.61
R1579:Zfp407 UTSW 18 84209638 missense probably benign 0.00
R1594:Zfp407 UTSW 18 84209331 missense probably benign 0.01
R1628:Zfp407 UTSW 18 84354533 missense probably damaging 1.00
R1698:Zfp407 UTSW 18 84562157 missense probably damaging 1.00
R1962:Zfp407 UTSW 18 84559336 missense probably benign 0.01
R1984:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1985:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1986:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R2151:Zfp407 UTSW 18 84209649 missense possibly damaging 0.55
R2152:Zfp407 UTSW 18 84209649 missense possibly damaging 0.55
R2154:Zfp407 UTSW 18 84209649 missense possibly damaging 0.55
R2259:Zfp407 UTSW 18 84209793 missense probably damaging 1.00
R2353:Zfp407 UTSW 18 84559880 missense probably damaging 1.00
R2845:Zfp407 UTSW 18 84558397 nonsense probably null
R3407:Zfp407 UTSW 18 84558872 missense probably benign 0.08
R3432:Zfp407 UTSW 18 84208746 missense probably damaging 1.00
R3892:Zfp407 UTSW 18 84560352 missense probably damaging 1.00
R4026:Zfp407 UTSW 18 84559596 missense possibly damaging 0.82
R4107:Zfp407 UTSW 18 84343007 missense possibly damaging 0.82
R4398:Zfp407 UTSW 18 84562731 nonsense probably null
R4447:Zfp407 UTSW 18 84562694 missense possibly damaging 0.95
R4752:Zfp407 UTSW 18 84562914 missense probably benign 0.01
R4881:Zfp407 UTSW 18 84559703 missense probably benign 0.27
R4936:Zfp407 UTSW 18 84559464 missense probably benign 0.00
R5194:Zfp407 UTSW 18 84561309 missense probably benign 0.05
R5243:Zfp407 UTSW 18 84561091 missense probably damaging 1.00
R5258:Zfp407 UTSW 18 84315926 missense probably damaging 1.00
R5591:Zfp407 UTSW 18 84561137 missense probably damaging 1.00
R5633:Zfp407 UTSW 18 84561044 missense probably benign 0.35
R5739:Zfp407 UTSW 18 84208742 makesense probably null
R5806:Zfp407 UTSW 18 84558614 missense probably damaging 1.00
R5820:Zfp407 UTSW 18 84560524 missense probably benign 0.01
R6187:Zfp407 UTSW 18 84559009 missense possibly damaging 0.87
R6512:Zfp407 UTSW 18 84560349 missense probably damaging 1.00
R6521:Zfp407 UTSW 18 84432411 missense probably damaging 1.00
R6748:Zfp407 UTSW 18 84208830 missense probably damaging 0.98
R6882:Zfp407 UTSW 18 84343069 splice site probably null
R6899:Zfp407 UTSW 18 84561434 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- ACAACTGTCACTGAATCAGGAGCAC -3'
(R):5'- TCTGGAGATGGAGAGCTTAGCAGTC -3'

Sequencing Primer
(F):5'- CAGATGACTGGTGTGGATGT -3'
(R):5'- GAGAGCTTAGCAGTCAACTCTCTG -3'
Posted On2014-03-17