Incidental Mutation 'R1484:Pigo'
ID163291
Institutional Source Beutler Lab
Gene Symbol Pigo
Ensembl Gene ENSMUSG00000028454
Gene Namephosphatidylinositol glycan anchor biosynthesis, class O
Synonyms
MMRRC Submission 039537-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.458) question?
Stock #R1484 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location43017635-43025819 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 43024779 bp
ZygosityHeterozygous
Amino Acid Change Proline to Alanine at position 107 (P107A)
Ref Sequence ENSEMBL: ENSMUSP00000095713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030169] [ENSMUST00000067481] [ENSMUST00000098109] [ENSMUST00000136326] [ENSMUST00000138030]
Predicted Effect probably benign
Transcript: ENSMUST00000030169
SMART Domains Protein: ENSMUSP00000030169
Gene: ENSMUSG00000028455

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
PHB 36 194 1.47e-57 SMART
coiled coil region 231 252 N/A INTRINSIC
Pfam:Band_7_C 259 321 2.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000067481
AA Change: P99A

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000069749
Gene: ENSMUSG00000028454
AA Change: P99A

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Phosphodiest 173 300 7.3e-17 PFAM
low complexity region 308 321 N/A INTRINSIC
low complexity region 323 336 N/A INTRINSIC
low complexity region 349 360 N/A INTRINSIC
low complexity region 417 428 N/A INTRINSIC
transmembrane domain 448 470 N/A INTRINSIC
transmembrane domain 477 499 N/A INTRINSIC
transmembrane domain 509 528 N/A INTRINSIC
low complexity region 539 559 N/A INTRINSIC
transmembrane domain 669 688 N/A INTRINSIC
transmembrane domain 703 722 N/A INTRINSIC
transmembrane domain 743 765 N/A INTRINSIC
transmembrane domain 829 851 N/A INTRINSIC
transmembrane domain 858 880 N/A INTRINSIC
transmembrane domain 921 940 N/A INTRINSIC
low complexity region 955 979 N/A INTRINSIC
transmembrane domain 992 1014 N/A INTRINSIC
transmembrane domain 1029 1051 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098109
AA Change: P107A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000095713
Gene: ENSMUSG00000028454
AA Change: P107A

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:Phosphodiest 129 304 6.5e-18 PFAM
low complexity region 316 329 N/A INTRINSIC
low complexity region 331 344 N/A INTRINSIC
low complexity region 357 368 N/A INTRINSIC
low complexity region 425 436 N/A INTRINSIC
transmembrane domain 456 478 N/A INTRINSIC
transmembrane domain 485 507 N/A INTRINSIC
transmembrane domain 517 536 N/A INTRINSIC
low complexity region 547 567 N/A INTRINSIC
transmembrane domain 677 696 N/A INTRINSIC
transmembrane domain 711 730 N/A INTRINSIC
transmembrane domain 751 773 N/A INTRINSIC
transmembrane domain 837 859 N/A INTRINSIC
transmembrane domain 866 888 N/A INTRINSIC
transmembrane domain 953 972 N/A INTRINSIC
low complexity region 987 1011 N/A INTRINSIC
transmembrane domain 1024 1046 N/A INTRINSIC
transmembrane domain 1061 1083 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123465
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125180
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131506
Predicted Effect probably benign
Transcript: ENSMUST00000135660
SMART Domains Protein: ENSMUSP00000123478
Gene: ENSMUSG00000028455

DomainStartEndE-ValueType
PHB 2 153 4.16e-39 SMART
coiled coil region 189 210 N/A INTRINSIC
Pfam:Band_7_C 218 280 3.6e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136326
SMART Domains Protein: ENSMUSP00000117586
Gene: ENSMUSG00000028455

DomainStartEndE-ValueType
PHB 1 148 1.33e-37 SMART
coiled coil region 185 206 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138030
SMART Domains Protein: ENSMUSP00000118465
Gene: ENSMUSG00000028455

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
PHB 42 200 1.47e-57 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142781
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143371
Predicted Effect unknown
Transcript: ENSMUST00000149333
AA Change: P101A
SMART Domains Protein: ENSMUSP00000114917
Gene: ENSMUSG00000028454
AA Change: P101A

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Phosphodiest 123 299 2.7e-18 PFAM
low complexity region 311 324 N/A INTRINSIC
low complexity region 326 339 N/A INTRINSIC
low complexity region 352 363 N/A INTRINSIC
low complexity region 420 431 N/A INTRINSIC
low complexity region 450 460 N/A INTRINSIC
transmembrane domain 531 550 N/A INTRINSIC
low complexity region 565 589 N/A INTRINSIC
transmembrane domain 602 624 N/A INTRINSIC
transmembrane domain 639 661 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153203
Meta Mutation Damage Score 0.174 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.4%
Validation Efficiency 97% (85/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is involved in glycosylphosphatidylinositol (GPI)-anchor biosynthesis. The GPI-anchor is a glycolipid which contains three mannose molecules in its core backbone. The GPI-anchor is found on many blood cells and serves to anchor proteins to the cell surface. This protein is involved in the transfer of ethanolaminephosphate (EtNP) to the third mannose in GPI. At least three alternatively spliced transcripts encoding two distinct isoforms have been found for this gene. [provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930584F24Rik A T 5: 26,479,778 noncoding transcript Het
Acvr1 A T 2: 58,479,889 V36E probably damaging Het
Aldh4a1 A G 4: 139,643,447 I414V probably benign Het
Alox5 C T 6: 116,454,167 C100Y probably damaging Het
Ano5 T A 7: 51,566,320 D348E probably damaging Het
Arhgap30 G A 1: 171,403,271 V199M probably damaging Het
Arl13b T A 16: 62,806,636 Q234L probably benign Het
Atxn1 C A 13: 45,557,576 E627* probably null Het
Bend3 T C 10: 43,510,201 F197L probably benign Het
Brca1 A T 11: 101,529,812 V190E possibly damaging Het
Brpf1 T C 6: 113,315,135 W381R probably damaging Het
Brwd1 A C 16: 96,028,291 probably null Het
C1s2 T C 6: 124,625,645 I530V possibly damaging Het
C2cd3 C T 7: 100,440,190 R1638W probably damaging Het
Capns1 T A 7: 30,194,086 probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cep126 G A 9: 8,100,553 T660I possibly damaging Het
Cep295 A C 9: 15,334,784 I744R probably damaging Het
Chd3 T C 11: 69,359,899 E668G probably benign Het
Chek2 A G 5: 110,848,687 T172A probably damaging Het
Col6a4 A G 9: 106,013,302 probably null Het
Coq3 G A 4: 21,900,291 V173I probably benign Het
Cyp4x1 A T 4: 115,112,901 I343N probably damaging Het
D430042O09Rik C A 7: 125,816,571 probably benign Het
Dnah7b T A 1: 46,137,543 D774E probably benign Het
Ecm1 G A 3: 95,735,963 R342C probably damaging Het
Esrra T C 19: 6,912,829 Y209C probably damaging Het
Gpr149 A T 3: 62,595,171 D421E probably benign Het
Gpr15 T C 16: 58,718,574 N51D probably damaging Het
Gpr156 T C 16: 37,992,196 V298A probably damaging Het
Hmcn2 G A 2: 31,346,495 G350D probably damaging Het
Ifih1 A T 2: 62,610,558 N421K probably benign Het
Ilvbl C A 10: 78,576,730 T95K probably damaging Het
Itgb4 T A 11: 115,999,799 D1104E probably benign Het
Lipf A T 19: 33,964,780 M37L probably benign Het
Lyst T A 13: 13,678,190 N2258K probably benign Het
Moxd1 A G 10: 24,223,860 Y86C probably damaging Het
Muc5ac T C 7: 141,813,892 probably null Het
Myo16 G A 8: 10,560,145 R1162H probably damaging Het
Myo5c A T 9: 75,300,810 N1609Y probably damaging Het
Nbeal1 T C 1: 60,200,939 F155L probably damaging Het
Nek4 A T 14: 30,982,333 M602L possibly damaging Het
Nek9 A G 12: 85,301,848 S971P probably damaging Het
Nfya A T 17: 48,393,542 probably benign Het
Nrxn3 A T 12: 89,254,777 N442I probably damaging Het
Nupl2 A C 5: 24,178,077 K200N probably benign Het
Olfr1216 G A 2: 89,013,369 R232* probably null Het
Olfr385 T A 11: 73,589,361 I126L possibly damaging Het
Olfr850 G A 9: 19,478,127 T38I probably damaging Het
Pcdh15 T A 10: 74,291,001 I304N probably damaging Het
Plce1 C T 19: 38,705,339 Q769* probably null Het
Plin2 C T 4: 86,657,244 R356H probably benign Het
Ppp1r9a G T 6: 5,113,712 E739* probably null Het
Ppp3cc G T 14: 70,240,948 N268K probably damaging Het
Prkag3 T A 1: 74,740,760 D472V probably damaging Het
Ptch2 A T 4: 117,110,849 D846V probably damaging Het
Rhob A T 12: 8,499,388 M82K probably damaging Het
Rps6kc1 T A 1: 190,799,475 R777W possibly damaging Het
Sap130 T A 18: 31,711,327 V850E probably damaging Het
Sema3a T G 5: 13,473,440 N125K probably damaging Het
Sema5a A G 15: 32,460,285 D64G probably damaging Het
Sgo2b T A 8: 63,931,473 D163V possibly damaging Het
Slc15a1 A T 14: 121,491,239 Y31* probably null Het
Smchd1 A T 17: 71,378,257 M1392K probably benign Het
Sobp T A 10: 43,160,831 N37I probably damaging Het
Spock3 G T 8: 63,220,705 C142F probably damaging Het
Stx6 A C 1: 155,177,904 S86R probably benign Het
Sult2a4 C A 7: 13,909,801 M280I probably benign Het
Synm A T 7: 67,736,332 D527E probably damaging Het
Tax1bp1 C T 6: 52,733,320 R195W probably damaging Het
Themis2 A T 4: 132,792,485 N76K possibly damaging Het
Tmem8b A G 4: 43,690,234 T890A probably benign Het
Traf7 T A 17: 24,511,811 H366L possibly damaging Het
Trim30c A T 7: 104,383,252 V289D probably benign Het
Tsr1 T A 11: 74,902,088 D407E probably damaging Het
Ubap2 G T 4: 41,235,593 A33E probably damaging Het
Unc13d C A 11: 116,073,875 R255L possibly damaging Het
Ush2a G T 1: 188,810,337 G3367* probably null Het
Vmn1r229 T C 17: 20,814,529 L12P probably damaging Het
Vmn2r27 C A 6: 124,200,515 G510V probably damaging Het
Vps4b T C 1: 106,779,982 E257G probably damaging Het
Vps72 T C 3: 95,119,151 S136P probably damaging Het
Wdr36 T C 18: 32,843,885 I181T possibly damaging Het
Wdr63 T C 3: 146,097,241 D65G probably benign Het
Wfikkn1 C T 17: 25,877,791 A520T probably benign Het
Other mutations in Pigo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Pigo APN 4 43021767 missense possibly damaging 0.63
IGL02176:Pigo APN 4 43019352 missense probably benign 0.20
IGL03197:Pigo APN 4 43022103 missense possibly damaging 0.92
R0207:Pigo UTSW 4 43023824 splice site probably benign
R0464:Pigo UTSW 4 43019814 missense probably benign 0.02
R0891:Pigo UTSW 4 43020519 nonsense probably null
R1445:Pigo UTSW 4 43021460 missense probably benign
R1547:Pigo UTSW 4 43020689 missense probably benign 0.01
R1624:Pigo UTSW 4 43024661 missense probably damaging 1.00
R1847:Pigo UTSW 4 43024710 nonsense probably null
R3110:Pigo UTSW 4 43021083 missense probably benign 0.00
R3111:Pigo UTSW 4 43021083 missense probably benign 0.00
R3112:Pigo UTSW 4 43021083 missense probably benign 0.00
R3824:Pigo UTSW 4 43020909 missense possibly damaging 0.95
R3850:Pigo UTSW 4 43025084 missense probably benign 0.01
R3980:Pigo UTSW 4 43019231 missense probably damaging 1.00
R3982:Pigo UTSW 4 43023482 missense probably benign 0.00
R4520:Pigo UTSW 4 43020301 missense probably benign 0.16
R5033:Pigo UTSW 4 43019412 missense probably null 1.00
R5054:Pigo UTSW 4 43021337 missense probably damaging 1.00
R5240:Pigo UTSW 4 43020675 missense possibly damaging 0.95
R5390:Pigo UTSW 4 43019645 critical splice donor site probably null
R5468:Pigo UTSW 4 43024562 critical splice donor site probably null
R5775:Pigo UTSW 4 43023475 missense probably damaging 1.00
R5839:Pigo UTSW 4 43022104 missense probably damaging 1.00
R5924:Pigo UTSW 4 43023389 nonsense probably null
R6111:Pigo UTSW 4 43019724 missense probably benign 0.18
R6451:Pigo UTSW 4 43021412 missense probably benign
R6533:Pigo UTSW 4 43022697 missense probably benign 0.07
R6884:Pigo UTSW 4 43022627 missense possibly damaging 0.88
R7026:Pigo UTSW 4 43023380 nonsense probably null
Z1088:Pigo UTSW 4 43019409 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGGCACATACTGACCTGCACTG -3'
(R):5'- ACGCTGGCATTGCACTCTTCAC -3'

Sequencing Primer
(F):5'- ACATACTGACCTGCACTGTTGAG -3'
(R):5'- GCACTCTTCACCAGTGGC -3'
Posted On2014-03-28