Incidental Mutation 'R1484:C2cd3'
ID163315
Institutional Source Beutler Lab
Gene Symbol C2cd3
Ensembl Gene ENSMUSG00000047248
Gene NameC2 calcium-dependent domain containing 3
Synonyms
MMRRC Submission 039537-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1484 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location100372233-100470152 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 100440190 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 1638 (R1638W)
Ref Sequence ENSEMBL: ENSMUSP00000062637 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051777] [ENSMUST00000098259] [ENSMUST00000120196]
Predicted Effect probably damaging
Transcript: ENSMUST00000051777
AA Change: R1638W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062637
Gene: ENSMUSG00000047248
AA Change: R1638W

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 406 417 N/A INTRINSIC
C2 524 662 2.36e1 SMART
C2 790 899 3.73e0 SMART
C2 989 1129 1.47e1 SMART
C2 1182 1321 1.63e1 SMART
C2 1617 1724 1.43e-2 SMART
low complexity region 1892 1906 N/A INTRINSIC
low complexity region 2037 2049 N/A INTRINSIC
low complexity region 2110 2125 N/A INTRINSIC
low complexity region 2180 2197 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098259
AA Change: R1638W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095859
Gene: ENSMUSG00000047248
AA Change: R1638W

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 406 417 N/A INTRINSIC
C2 524 662 2.36e1 SMART
C2 790 899 3.73e0 SMART
C2 989 1129 1.47e1 SMART
C2 1182 1321 1.63e1 SMART
C2 1617 1724 1.43e-2 SMART
low complexity region 1892 1906 N/A INTRINSIC
low complexity region 2037 2049 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000119647
AA Change: R1260W
SMART Domains Protein: ENSMUSP00000113360
Gene: ENSMUSG00000047248
AA Change: R1260W

DomainStartEndE-ValueType
C2 61 199 2.36e1 SMART
C2 327 436 3.73e0 SMART
C2 526 666 1.47e1 SMART
C2 719 858 1.63e1 SMART
C2 1154 1261 1.43e-2 SMART
low complexity region 1429 1443 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120196
AA Change: R407W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113728
Gene: ENSMUSG00000047248
AA Change: R407W

DomainStartEndE-ValueType
low complexity region 297 308 N/A INTRINSIC
C2 415 553 1.5e-1 SMART
C2 681 790 2.4e-2 SMART
C2 880 1020 9.5e-2 SMART
C2 1073 1212 1.1e-1 SMART
C2 1508 1615 9e-5 SMART
low complexity region 1783 1797 N/A INTRINSIC
low complexity region 1928 1940 N/A INTRINSIC
low complexity region 2001 2016 N/A INTRINSIC
low complexity region 2071 2087 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184779
Meta Mutation Damage Score 0.22 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.4%
Validation Efficiency 97% (85/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions as a regulator of centriole elongation. Studies of the orthologous mouse protein show that it promotes centriolar distal appendage assembly and is also required for the recruitment of other ciliogenic proteins, including intraflagellar transport proteins. Mutations in this gene cause orofaciodigital syndrome XIV (OFD14), a ciliopathy resulting in malformations of the oral cavity, face and digits. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygotes inactivating allele are embryonic lethal with pericardial edema and twisted body axis, abnormal patterning of brain and open neural tube defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930584F24Rik A T 5: 26,479,778 noncoding transcript Het
Acvr1 A T 2: 58,479,889 V36E probably damaging Het
Aldh4a1 A G 4: 139,643,447 I414V probably benign Het
Alox5 C T 6: 116,454,167 C100Y probably damaging Het
Ano5 T A 7: 51,566,320 D348E probably damaging Het
Arhgap30 G A 1: 171,403,271 V199M probably damaging Het
Arl13b T A 16: 62,806,636 Q234L probably benign Het
Atxn1 C A 13: 45,557,576 E627* probably null Het
Bend3 T C 10: 43,510,201 F197L probably benign Het
Brca1 A T 11: 101,529,812 V190E possibly damaging Het
Brpf1 T C 6: 113,315,135 W381R probably damaging Het
Brwd1 A C 16: 96,028,291 probably null Het
C1s2 T C 6: 124,625,645 I530V possibly damaging Het
Capns1 T A 7: 30,194,086 probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cep126 G A 9: 8,100,553 T660I possibly damaging Het
Cep295 A C 9: 15,334,784 I744R probably damaging Het
Chd3 T C 11: 69,359,899 E668G probably benign Het
Chek2 A G 5: 110,848,687 T172A probably damaging Het
Col6a4 A G 9: 106,013,302 probably null Het
Coq3 G A 4: 21,900,291 V173I probably benign Het
Cyp4x1 A T 4: 115,112,901 I343N probably damaging Het
D430042O09Rik C A 7: 125,816,571 probably benign Het
Dnah7b T A 1: 46,137,543 D774E probably benign Het
Ecm1 G A 3: 95,735,963 R342C probably damaging Het
Esrra T C 19: 6,912,829 Y209C probably damaging Het
Gpr149 A T 3: 62,595,171 D421E probably benign Het
Gpr15 T C 16: 58,718,574 N51D probably damaging Het
Gpr156 T C 16: 37,992,196 V298A probably damaging Het
Hmcn2 G A 2: 31,346,495 G350D probably damaging Het
Ifih1 A T 2: 62,610,558 N421K probably benign Het
Ilvbl C A 10: 78,576,730 T95K probably damaging Het
Itgb4 T A 11: 115,999,799 D1104E probably benign Het
Lipf A T 19: 33,964,780 M37L probably benign Het
Lyst T A 13: 13,678,190 N2258K probably benign Het
Moxd1 A G 10: 24,223,860 Y86C probably damaging Het
Muc5ac T C 7: 141,813,892 probably null Het
Myo16 G A 8: 10,560,145 R1162H probably damaging Het
Myo5c A T 9: 75,300,810 N1609Y probably damaging Het
Nbeal1 T C 1: 60,200,939 F155L probably damaging Het
Nek4 A T 14: 30,982,333 M602L possibly damaging Het
Nek9 A G 12: 85,301,848 S971P probably damaging Het
Nfya A T 17: 48,393,542 probably benign Het
Nrxn3 A T 12: 89,254,777 N442I probably damaging Het
Nupl2 A C 5: 24,178,077 K200N probably benign Het
Olfr1216 G A 2: 89,013,369 R232* probably null Het
Olfr385 T A 11: 73,589,361 I126L possibly damaging Het
Olfr850 G A 9: 19,478,127 T38I probably damaging Het
Pcdh15 T A 10: 74,291,001 I304N probably damaging Het
Pigo G C 4: 43,024,779 P107A probably damaging Het
Plce1 C T 19: 38,705,339 Q769* probably null Het
Plin2 C T 4: 86,657,244 R356H probably benign Het
Ppp1r9a G T 6: 5,113,712 E739* probably null Het
Ppp3cc G T 14: 70,240,948 N268K probably damaging Het
Prkag3 T A 1: 74,740,760 D472V probably damaging Het
Ptch2 A T 4: 117,110,849 D846V probably damaging Het
Rhob A T 12: 8,499,388 M82K probably damaging Het
Rps6kc1 T A 1: 190,799,475 R777W possibly damaging Het
Sap130 T A 18: 31,711,327 V850E probably damaging Het
Sema3a T G 5: 13,473,440 N125K probably damaging Het
Sema5a A G 15: 32,460,285 D64G probably damaging Het
Sgo2b T A 8: 63,931,473 D163V possibly damaging Het
Slc15a1 A T 14: 121,491,239 Y31* probably null Het
Smchd1 A T 17: 71,378,257 M1392K probably benign Het
Sobp T A 10: 43,160,831 N37I probably damaging Het
Spock3 G T 8: 63,220,705 C142F probably damaging Het
Stx6 A C 1: 155,177,904 S86R probably benign Het
Sult2a4 C A 7: 13,909,801 M280I probably benign Het
Synm A T 7: 67,736,332 D527E probably damaging Het
Tax1bp1 C T 6: 52,733,320 R195W probably damaging Het
Themis2 A T 4: 132,792,485 N76K possibly damaging Het
Tmem8b A G 4: 43,690,234 T890A probably benign Het
Traf7 T A 17: 24,511,811 H366L possibly damaging Het
Trim30c A T 7: 104,383,252 V289D probably benign Het
Tsr1 T A 11: 74,902,088 D407E probably damaging Het
Ubap2 G T 4: 41,235,593 A33E probably damaging Het
Unc13d C A 11: 116,073,875 R255L possibly damaging Het
Ush2a G T 1: 188,810,337 G3367* probably null Het
Vmn1r229 T C 17: 20,814,529 L12P probably damaging Het
Vmn2r27 C A 6: 124,200,515 G510V probably damaging Het
Vps4b T C 1: 106,779,982 E257G probably damaging Het
Vps72 T C 3: 95,119,151 S136P probably damaging Het
Wdr36 T C 18: 32,843,885 I181T possibly damaging Het
Wdr63 T C 3: 146,097,241 D65G probably benign Het
Wfikkn1 C T 17: 25,877,791 A520T probably benign Het
Other mutations in C2cd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:C2cd3 APN 7 100391128 missense probably benign 0.14
IGL01420:C2cd3 APN 7 100454858 missense probably benign 0.35
IGL01775:C2cd3 APN 7 100443431 missense probably damaging 1.00
IGL01832:C2cd3 APN 7 100427214 missense possibly damaging 0.94
IGL01883:C2cd3 APN 7 100374486 missense possibly damaging 0.80
IGL02664:C2cd3 APN 7 100419715 missense possibly damaging 0.67
IGL02697:C2cd3 APN 7 100427169 unclassified probably benign
IGL02852:C2cd3 APN 7 100430189 missense probably damaging 1.00
IGL03158:C2cd3 APN 7 100374476 missense probably damaging 1.00
R0012:C2cd3 UTSW 7 100418522 missense possibly damaging 0.52
R0012:C2cd3 UTSW 7 100418522 missense possibly damaging 0.52
R0013:C2cd3 UTSW 7 100416062 missense probably damaging 1.00
R0013:C2cd3 UTSW 7 100416062 missense probably damaging 1.00
R0032:C2cd3 UTSW 7 100444445 unclassified probably benign
R0032:C2cd3 UTSW 7 100444445 unclassified probably benign
R0124:C2cd3 UTSW 7 100469518 missense probably benign
R0387:C2cd3 UTSW 7 100422507 splice site probably benign
R0522:C2cd3 UTSW 7 100395222 missense probably benign 0.14
R1124:C2cd3 UTSW 7 100422681 missense probably benign 0.00
R1533:C2cd3 UTSW 7 100406077 missense possibly damaging 0.54
R1631:C2cd3 UTSW 7 100372497 critical splice donor site probably null
R1875:C2cd3 UTSW 7 100407025 missense possibly damaging 0.89
R2059:C2cd3 UTSW 7 100455493 unclassified probably benign
R2060:C2cd3 UTSW 7 100454948 missense probably damaging 1.00
R2348:C2cd3 UTSW 7 100413366 missense probably damaging 1.00
R3103:C2cd3 UTSW 7 100395252 missense possibly damaging 0.47
R3405:C2cd3 UTSW 7 100390166 missense probably benign 0.01
R3687:C2cd3 UTSW 7 100435833 missense probably benign 0.28
R3775:C2cd3 UTSW 7 100431998 missense probably damaging 1.00
R3854:C2cd3 UTSW 7 100454601 critical splice acceptor site probably null
R4359:C2cd3 UTSW 7 100441089 missense probably damaging 1.00
R4403:C2cd3 UTSW 7 100432099 missense probably damaging 1.00
R4446:C2cd3 UTSW 7 100374477 missense probably damaging 1.00
R4646:C2cd3 UTSW 7 100372450 unclassified probably benign
R4705:C2cd3 UTSW 7 100395188 missense possibly damaging 0.77
R4770:C2cd3 UTSW 7 100443435 missense probably damaging 1.00
R4777:C2cd3 UTSW 7 100416332 missense possibly damaging 0.46
R4816:C2cd3 UTSW 7 100391019 missense probably benign 0.01
R4842:C2cd3 UTSW 7 100416190 missense probably benign 0.00
R4858:C2cd3 UTSW 7 100454953 missense probably damaging 1.00
R4871:C2cd3 UTSW 7 100413374 missense possibly damaging 0.79
R4898:C2cd3 UTSW 7 100405959 missense probably damaging 1.00
R5026:C2cd3 UTSW 7 100459842 missense possibly damaging 0.52
R5112:C2cd3 UTSW 7 100443485 missense possibly damaging 0.91
R5242:C2cd3 UTSW 7 100390166 missense probably benign 0.01
R5538:C2cd3 UTSW 7 100455493 critical splice donor site probably null
R5861:C2cd3 UTSW 7 100444475 unclassified probably benign
R6110:C2cd3 UTSW 7 100441076 missense probably damaging 1.00
R6326:C2cd3 UTSW 7 100416428 missense probably benign 0.02
R6429:C2cd3 UTSW 7 100432091 missense probably damaging 1.00
R6610:C2cd3 UTSW 7 100455298 missense probably benign
R6613:C2cd3 UTSW 7 100395241 missense possibly damaging 0.87
R6631:C2cd3 UTSW 7 100418540 missense probably damaging 1.00
R6787:C2cd3 UTSW 7 100455346 missense probably benign
R6837:C2cd3 UTSW 7 100448746 missense probably damaging 1.00
R6849:C2cd3 UTSW 7 100406927 missense probably damaging 1.00
R6860:C2cd3 UTSW 7 100390241 missense probably benign 0.28
R6929:C2cd3 UTSW 7 100451619 missense probably damaging 1.00
R7026:C2cd3 UTSW 7 100432092 missense probably damaging 1.00
R7088:C2cd3 UTSW 7 100416181 missense not run
X0002:C2cd3 UTSW 7 100440235 missense possibly damaging 0.50
Predicted Primers
Posted On2014-03-28