Incidental Mutation 'R1484:Nfya'
ID163356
Institutional Source Beutler Lab
Gene Symbol Nfya
Ensembl Gene ENSMUSG00000023994
Gene Namenuclear transcription factor-Y alpha
SynonymsSez10, Cbf-b
MMRRC Submission 039537-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1484 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location48386885-48409906 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 48393542 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125034 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046719] [ENSMUST00000078800] [ENSMUST00000159063] [ENSMUST00000159535] [ENSMUST00000160319] [ENSMUST00000161117] [ENSMUST00000161256] [ENSMUST00000162460]
Predicted Effect unknown
Transcript: ENSMUST00000046719
AA Change: V107E
SMART Domains Protein: ENSMUSP00000043909
Gene: ENSMUSG00000023994
AA Change: V107E

DomainStartEndE-ValueType
low complexity region 14 37 N/A INTRINSIC
low complexity region 39 58 N/A INTRINSIC
low complexity region 99 167 N/A INTRINSIC
low complexity region 205 223 N/A INTRINSIC
low complexity region 226 240 N/A INTRINSIC
CBF 260 321 3.92e-35 SMART
Predicted Effect unknown
Transcript: ENSMUST00000078800
AA Change: V106E
SMART Domains Protein: ENSMUSP00000077853
Gene: ENSMUSG00000023994
AA Change: V106E

DomainStartEndE-ValueType
low complexity region 14 36 N/A INTRINSIC
low complexity region 38 57 N/A INTRINSIC
low complexity region 98 166 N/A INTRINSIC
low complexity region 204 222 N/A INTRINSIC
low complexity region 225 239 N/A INTRINSIC
CBF 259 320 3.92e-35 SMART
Predicted Effect unknown
Transcript: ENSMUST00000159063
AA Change: V78E
SMART Domains Protein: ENSMUSP00000124404
Gene: ENSMUSG00000023994
AA Change: V78E

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
low complexity region 70 138 N/A INTRINSIC
low complexity region 170 188 N/A INTRINSIC
low complexity region 191 205 N/A INTRINSIC
CBF 225 286 3.92e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159237
SMART Domains Protein: ENSMUSP00000124115
Gene: ENSMUSG00000023994

DomainStartEndE-ValueType
low complexity region 66 84 N/A INTRINSIC
low complexity region 87 101 N/A INTRINSIC
CBF 121 182 3.92e-35 SMART
Predicted Effect unknown
Transcript: ENSMUST00000159535
AA Change: V105E
SMART Domains Protein: ENSMUSP00000124501
Gene: ENSMUSG00000023994
AA Change: V105E

DomainStartEndE-ValueType
low complexity region 14 36 N/A INTRINSIC
low complexity region 38 56 N/A INTRINSIC
internal_repeat_1 57 82 3.82e-6 PROSPERO
internal_repeat_1 74 95 3.82e-6 PROSPERO
low complexity region 97 165 N/A INTRINSIC
low complexity region 197 215 N/A INTRINSIC
low complexity region 218 232 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000160319
AA Change: V107E
SMART Domains Protein: ENSMUSP00000124245
Gene: ENSMUSG00000023994
AA Change: V107E

DomainStartEndE-ValueType
low complexity region 14 37 N/A INTRINSIC
low complexity region 39 58 N/A INTRINSIC
low complexity region 99 167 N/A INTRINSIC
low complexity region 199 217 N/A INTRINSIC
low complexity region 220 234 N/A INTRINSIC
CBF 254 315 3.92e-35 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160804
Predicted Effect unknown
Transcript: ENSMUST00000161117
AA Change: V72E
SMART Domains Protein: ENSMUSP00000124965
Gene: ENSMUSG00000023994
AA Change: V72E

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
internal_repeat_1 24 49 2.33e-5 PROSPERO
internal_repeat_1 41 62 2.33e-5 PROSPERO
low complexity region 64 132 N/A INTRINSIC
low complexity region 170 188 N/A INTRINSIC
low complexity region 191 205 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161256
SMART Domains Protein: ENSMUSP00000125034
Gene: ENSMUSG00000023994

DomainStartEndE-ValueType
low complexity region 1 33 N/A INTRINSIC
low complexity region 69 87 N/A INTRINSIC
low complexity region 90 104 N/A INTRINSIC
CBF 124 185 9.8e-38 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161603
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161686
Predicted Effect unknown
Transcript: ENSMUST00000162460
AA Change: V78E
SMART Domains Protein: ENSMUSP00000123785
Gene: ENSMUSG00000023994
AA Change: V78E

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
low complexity region 70 138 N/A INTRINSIC
low complexity region 176 194 N/A INTRINSIC
low complexity region 197 211 N/A INTRINSIC
CBF 231 292 3.92e-35 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163066
Meta Mutation Damage Score 0.0636 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.4%
Validation Efficiency 97% (85/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one subunit of a trimeric complex, forming a highly conserved transcription factor that binds to CCAAT motifs in the promoter regions in a variety of genes. Subunit A associates with a tight dimer composed of the B and C subunits, resulting in a trimer that binds to DNA with high specificity and affinity. The sequence specific interactions of the complex are made by the A subunit, suggesting a role as the regulatory subunit. In addition, there is evidence of post-transcriptional regulation in this gene product, either by protein degradation or control of translation. Further regulation is represented by alternative splicing in the glutamine-rich activation domain, with clear tissue-specific preferences for the two isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Inactivation of this locus impairs development and results in embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930584F24Rik A T 5: 26,479,778 noncoding transcript Het
Acvr1 A T 2: 58,479,889 V36E probably damaging Het
Aldh4a1 A G 4: 139,643,447 I414V probably benign Het
Alox5 C T 6: 116,454,167 C100Y probably damaging Het
Ano5 T A 7: 51,566,320 D348E probably damaging Het
Arhgap30 G A 1: 171,403,271 V199M probably damaging Het
Arl13b T A 16: 62,806,636 Q234L probably benign Het
Atxn1 C A 13: 45,557,576 E627* probably null Het
Bend3 T C 10: 43,510,201 F197L probably benign Het
Brca1 A T 11: 101,529,812 V190E possibly damaging Het
Brpf1 T C 6: 113,315,135 W381R probably damaging Het
Brwd1 A C 16: 96,028,291 probably null Het
C1s2 T C 6: 124,625,645 I530V possibly damaging Het
C2cd3 C T 7: 100,440,190 R1638W probably damaging Het
Capns1 T A 7: 30,194,086 probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cep126 G A 9: 8,100,553 T660I possibly damaging Het
Cep295 A C 9: 15,334,784 I744R probably damaging Het
Chd3 T C 11: 69,359,899 E668G probably benign Het
Chek2 A G 5: 110,848,687 T172A probably damaging Het
Col6a4 A G 9: 106,013,302 probably null Het
Coq3 G A 4: 21,900,291 V173I probably benign Het
Cyp4x1 A T 4: 115,112,901 I343N probably damaging Het
D430042O09Rik C A 7: 125,816,571 probably benign Het
Dnah7b T A 1: 46,137,543 D774E probably benign Het
Ecm1 G A 3: 95,735,963 R342C probably damaging Het
Esrra T C 19: 6,912,829 Y209C probably damaging Het
Gpr149 A T 3: 62,595,171 D421E probably benign Het
Gpr15 T C 16: 58,718,574 N51D probably damaging Het
Gpr156 T C 16: 37,992,196 V298A probably damaging Het
Hmcn2 G A 2: 31,346,495 G350D probably damaging Het
Ifih1 A T 2: 62,610,558 N421K probably benign Het
Ilvbl C A 10: 78,576,730 T95K probably damaging Het
Itgb4 T A 11: 115,999,799 D1104E probably benign Het
Lipf A T 19: 33,964,780 M37L probably benign Het
Lyst T A 13: 13,678,190 N2258K probably benign Het
Moxd1 A G 10: 24,223,860 Y86C probably damaging Het
Muc5ac T C 7: 141,813,892 probably null Het
Myo16 G A 8: 10,560,145 R1162H probably damaging Het
Myo5c A T 9: 75,300,810 N1609Y probably damaging Het
Nbeal1 T C 1: 60,200,939 F155L probably damaging Het
Nek4 A T 14: 30,982,333 M602L possibly damaging Het
Nek9 A G 12: 85,301,848 S971P probably damaging Het
Nrxn3 A T 12: 89,254,777 N442I probably damaging Het
Nupl2 A C 5: 24,178,077 K200N probably benign Het
Olfr1216 G A 2: 89,013,369 R232* probably null Het
Olfr385 T A 11: 73,589,361 I126L possibly damaging Het
Olfr850 G A 9: 19,478,127 T38I probably damaging Het
Pcdh15 T A 10: 74,291,001 I304N probably damaging Het
Pigo G C 4: 43,024,779 P107A probably damaging Het
Plce1 C T 19: 38,705,339 Q769* probably null Het
Plin2 C T 4: 86,657,244 R356H probably benign Het
Ppp1r9a G T 6: 5,113,712 E739* probably null Het
Ppp3cc G T 14: 70,240,948 N268K probably damaging Het
Prkag3 T A 1: 74,740,760 D472V probably damaging Het
Ptch2 A T 4: 117,110,849 D846V probably damaging Het
Rhob A T 12: 8,499,388 M82K probably damaging Het
Rps6kc1 T A 1: 190,799,475 R777W possibly damaging Het
Sap130 T A 18: 31,711,327 V850E probably damaging Het
Sema3a T G 5: 13,473,440 N125K probably damaging Het
Sema5a A G 15: 32,460,285 D64G probably damaging Het
Sgo2b T A 8: 63,931,473 D163V possibly damaging Het
Slc15a1 A T 14: 121,491,239 Y31* probably null Het
Smchd1 A T 17: 71,378,257 M1392K probably benign Het
Sobp T A 10: 43,160,831 N37I probably damaging Het
Spock3 G T 8: 63,220,705 C142F probably damaging Het
Stx6 A C 1: 155,177,904 S86R probably benign Het
Sult2a4 C A 7: 13,909,801 M280I probably benign Het
Synm A T 7: 67,736,332 D527E probably damaging Het
Tax1bp1 C T 6: 52,733,320 R195W probably damaging Het
Themis2 A T 4: 132,792,485 N76K possibly damaging Het
Tmem8b A G 4: 43,690,234 T890A probably benign Het
Traf7 T A 17: 24,511,811 H366L possibly damaging Het
Trim30c A T 7: 104,383,252 V289D probably benign Het
Tsr1 T A 11: 74,902,088 D407E probably damaging Het
Ubap2 G T 4: 41,235,593 A33E probably damaging Het
Unc13d C A 11: 116,073,875 R255L possibly damaging Het
Ush2a G T 1: 188,810,337 G3367* probably null Het
Vmn1r229 T C 17: 20,814,529 L12P probably damaging Het
Vmn2r27 C A 6: 124,200,515 G510V probably damaging Het
Vps4b T C 1: 106,779,982 E257G probably damaging Het
Vps72 T C 3: 95,119,151 S136P probably damaging Het
Wdr36 T C 18: 32,843,885 I181T possibly damaging Het
Wdr63 T C 3: 146,097,241 D65G probably benign Het
Wfikkn1 C T 17: 25,877,791 A520T probably benign Het
Other mutations in Nfya
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02127:Nfya APN 17 48393255 unclassified probably benign
IGL02348:Nfya APN 17 48393276 nonsense probably null
IGL03220:Nfya APN 17 48400493 missense possibly damaging 0.66
IGL03274:Nfya APN 17 48391347 missense probably damaging 1.00
R0147:Nfya UTSW 17 48398998 missense possibly damaging 0.46
R0148:Nfya UTSW 17 48398998 missense possibly damaging 0.46
R0904:Nfya UTSW 17 48395787 nonsense probably null
R4105:Nfya UTSW 17 48392884 nonsense probably null
R4108:Nfya UTSW 17 48392884 nonsense probably null
R4109:Nfya UTSW 17 48392884 nonsense probably null
R4923:Nfya UTSW 17 48400535 utr 5 prime probably benign
R5411:Nfya UTSW 17 48392018 missense possibly damaging 0.83
R6299:Nfya UTSW 17 48392910 intron probably benign
R6846:Nfya UTSW 17 48395687 missense probably benign 0.04
R6967:Nfya UTSW 17 48392904 intron probably benign
R7027:Nfya UTSW 17 48389312 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACGGAGACCCCATTTTGATGACG -3'
(R):5'- GCCTTTGCTGCCATCAGCATAAC -3'

Sequencing Primer
(F):5'- TCACATCCCATGTGAACCAGG -3'
(R):5'- cctaataaccctacctctgcc -3'
Posted On2014-03-28