Incidental Mutation 'R1485:Slc9a2'
ID163366
Institutional Source Beutler Lab
Gene Symbol Slc9a2
Ensembl Gene ENSMUSG00000026062
Gene Namesolute carrier family 9 (sodium/hydrogen exchanger), member 2
Synonyms2210416H12Rik, 4932415O19Rik, NHE2
MMRRC Submission 039538-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.024) question?
Stock #R1485 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location40680574-40769273 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 40726388 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 313 (L313F)
Ref Sequence ENSEMBL: ENSMUSP00000142144 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027231] [ENSMUST00000192345]
Predicted Effect probably damaging
Transcript: ENSMUST00000027231
AA Change: L313F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027231
Gene: ENSMUSG00000026062
AA Change: L313F

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
low complexity region 40 60 N/A INTRINSIC
Pfam:Na_H_Exchanger 85 486 1.4e-95 PFAM
low complexity region 528 543 N/A INTRINSIC
Pfam:NEXCaM_BD 576 685 3e-44 PFAM
low complexity region 738 753 N/A INTRINSIC
low complexity region 788 793 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000192345
AA Change: L313F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142144
Gene: ENSMUSG00000026062
AA Change: L313F

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
low complexity region 40 60 N/A INTRINSIC
Pfam:Na_H_Exchanger 85 336 2.5e-56 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium-hydrogen exchanger (NHE) protein family. These proteins are involved in sodium-ion transport by exchanging intracellular hydrogen ions to external sodium ions and help in the regulation of cell pH and volume. The encoded protein is localized to the apical membrane and is involved in apical absorption of sodium. [provided by RefSeq, Jun 2016]
PHENOTYPE: Gastric acid secretion is impaired in homozygous mutant mice. The gastric mucosa becomes inflamed and exhibits an altered cellular composition. Mutant mice do not breed well. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik A G 11: 78,285,580 Y1836C probably damaging Het
4930402H24Rik A G 2: 130,748,683 probably null Het
4931408C20Rik T G 1: 26,685,880 K73T possibly damaging Het
Adgrv1 A G 13: 81,579,619 S301P probably damaging Het
AI987944 C A 7: 41,374,530 G342* probably null Het
Alox5 A T 6: 116,424,164 F212I probably damaging Het
Apaf1 A T 10: 91,060,243 D322E probably benign Het
Aste1 T A 9: 105,397,810 Y355* probably null Het
Bloc1s6 T G 2: 122,746,143 probably null Het
Ccdc77 G A 6: 120,338,140 Q183* probably null Het
Ccdc92 T C 5: 124,836,271 T65A probably benign Het
Chrna2 C T 14: 66,143,363 A27V probably benign Het
Coch G T 12: 51,598,289 V209F probably damaging Het
Cops3 G A 11: 59,827,889 T193M possibly damaging Het
Cped1 T C 6: 22,132,388 probably null Het
D6Ertd527e A T 6: 87,111,085 S77C unknown Het
Defb7 A G 8: 19,495,094 probably null Het
Entpd6 T A 2: 150,768,923 probably null Het
Evc2 C T 5: 37,370,556 A303V probably benign Het
Fhod1 T C 8: 105,336,798 probably null Het
Gatsl2 T A 5: 134,137,133 L240Q probably damaging Het
Gcn1l1 T A 5: 115,574,617 F54I probably benign Het
Gm6768 A G 12: 119,261,050 noncoding transcript Het
Gm7104 C A 12: 88,285,563 noncoding transcript Het
Grid1 A T 14: 34,822,583 D37V probably damaging Het
Icam5 G A 9: 21,036,406 A560T probably benign Het
Igf2r A C 17: 12,691,285 I2019S probably damaging Het
Kcnj9 A G 1: 172,326,362 V65A probably benign Het
Kif3b T C 2: 153,322,931 probably null Het
Kmt2a T G 9: 44,826,928 probably benign Het
March6 T A 15: 31,498,693 T153S probably damaging Het
Mcam T A 9: 44,136,763 I72N probably damaging Het
Nkain3 T C 4: 20,484,932 I48M probably damaging Het
Nop58 T A 1: 59,698,345 I107N probably damaging Het
Notch2 A G 3: 98,100,257 H441R probably benign Het
Nr1d1 G A 11: 98,770,361 R360C probably benign Het
Olfr683 A G 7: 105,143,681 I210T probably benign Het
Pclo T C 5: 14,713,779 S4089P unknown Het
Pi4kb A G 3: 94,994,387 E455G probably damaging Het
Piezo1 T C 8: 122,482,049 Y2525C probably damaging Het
Pik3c2a A G 7: 116,417,673 V283A possibly damaging Het
Pramef8 G A 4: 143,417,618 R178Q probably benign Het
Rabgap1l A T 1: 160,733,680 V161E probably benign Het
Rasa2 A G 9: 96,544,348 I815T probably benign Het
Rev1 A T 1: 38,088,572 D202E probably benign Het
Sept14 C T 5: 129,693,054 A193T probably damaging Het
Sh3tc1 T C 5: 35,719,026 S112G probably benign Het
Siah3 T A 14: 75,525,554 Y82N probably benign Het
Slc2a7 T C 4: 150,166,396 S425P probably damaging Het
Smdt1 T C 15: 82,346,232 V50A probably benign Het
Supt3 G A 17: 45,036,720 A197T probably benign Het
Tex10 A G 4: 48,436,492 I742T possibly damaging Het
Tex44 T A 1: 86,427,918 H516Q possibly damaging Het
Tfdp1 T G 8: 13,370,917 D171E probably damaging Het
Trim31 A C 17: 36,898,676 D108A probably damaging Het
Ubr1 T C 2: 120,961,098 N135S probably benign Het
Uso1 G A 5: 92,180,563 V340I possibly damaging Het
Utp6 A C 11: 79,948,923 V313G probably damaging Het
Vmn2r107 T C 17: 20,374,847 V554A possibly damaging Het
Xdh C A 17: 73,914,019 E572* probably null Het
Zbtb7c T C 18: 76,136,990 S50P probably damaging Het
Zfp672 A G 11: 58,329,569 probably benign Het
Zzef1 A G 11: 72,900,809 probably null Het
Other mutations in Slc9a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Slc9a2 APN 1 40767737 missense probably benign
IGL00487:Slc9a2 APN 1 40742658 missense probably damaging 0.99
IGL00500:Slc9a2 APN 1 40763583 missense possibly damaging 0.95
IGL01445:Slc9a2 APN 1 40718810 missense possibly damaging 0.51
IGL02060:Slc9a2 APN 1 40756293 missense probably damaging 0.99
IGL02813:Slc9a2 APN 1 40742669 missense probably damaging 1.00
IGL02894:Slc9a2 APN 1 40763602 missense probably benign 0.20
IGL02939:Slc9a2 APN 1 40742703 missense probably damaging 1.00
IGL03193:Slc9a2 APN 1 40756271 missense probably benign 0.00
E0370:Slc9a2 UTSW 1 40763541 critical splice acceptor site probably null
R0009:Slc9a2 UTSW 1 40763602 missense probably benign 0.38
R0009:Slc9a2 UTSW 1 40763602 missense probably benign 0.38
R0152:Slc9a2 UTSW 1 40742804 missense probably damaging 1.00
R0374:Slc9a2 UTSW 1 40743857 missense possibly damaging 0.93
R1386:Slc9a2 UTSW 1 40719018 missense probably damaging 1.00
R1712:Slc9a2 UTSW 1 40763610 missense possibly damaging 0.90
R1779:Slc9a2 UTSW 1 40742643 missense probably damaging 0.99
R2051:Slc9a2 UTSW 1 40726437 missense probably damaging 1.00
R2166:Slc9a2 UTSW 1 40742768 missense probably damaging 1.00
R2513:Slc9a2 UTSW 1 40742608 splice site probably null
R3612:Slc9a2 UTSW 1 40719058 splice site probably null
R4631:Slc9a2 UTSW 1 40761918 missense possibly damaging 0.66
R4760:Slc9a2 UTSW 1 40761916 missense probably damaging 1.00
R4768:Slc9a2 UTSW 1 40726374 missense probably damaging 1.00
R4769:Slc9a2 UTSW 1 40726374 missense probably damaging 1.00
R4815:Slc9a2 UTSW 1 40718849 missense probably benign 0.00
R4920:Slc9a2 UTSW 1 40755718 missense probably benign 0.05
R5191:Slc9a2 UTSW 1 40743893 missense probably damaging 1.00
R5963:Slc9a2 UTSW 1 40682036 missense possibly damaging 0.94
R6322:Slc9a2 UTSW 1 40742653 nonsense probably null
R6453:Slc9a2 UTSW 1 40742621 missense possibly damaging 0.64
R6685:Slc9a2 UTSW 1 40718909 missense probably damaging 0.99
X0054:Slc9a2 UTSW 1 40742687 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCCTTCTGCCAGATGAAAACCATCC -3'
(R):5'- GTTTCCGTGATGCAACCTTGCTG -3'

Sequencing Primer
(F):5'- CATCCAGACCGTAGACGTG -3'
(R):5'- ACTCAAGACGTTGGCATCTG -3'
Posted On2014-03-28