Incidental Mutation 'R1485:Ubr1'
ID163372
Institutional Source Beutler Lab
Gene Symbol Ubr1
Ensembl Gene ENSMUSG00000027272
Gene Nameubiquitin protein ligase E3 component n-recognin 1
SynonymsE3 alpha
MMRRC Submission 039538-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.743) question?
Stock #R1485 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location120860269-120970715 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120961098 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 135 (N135S)
Ref Sequence ENSEMBL: ENSMUSP00000028728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028728]
Predicted Effect probably benign
Transcript: ENSMUST00000028728
AA Change: N135S

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000028728
Gene: ENSMUSG00000027272
AA Change: N135S

DomainStartEndE-ValueType
ZnF_UBR1 97 167 1.24e-35 SMART
Pfam:ClpS 221 301 8e-24 PFAM
low complexity region 918 936 N/A INTRINSIC
low complexity region 1017 1030 N/A INTRINSIC
low complexity region 1070 1081 N/A INTRINSIC
Blast:RING 1101 1203 4e-34 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133408
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138824
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The N-end rule pathway is one proteolytic pathway of the ubiquitin system. The recognition component of this pathway, encoded by this gene, binds to a destabilizing N-terminal residue of a substrate protein and participates in the formation of a substrate-linked multiubiquitin chain. This leads to the eventual degradation of the substrate protein. The protein described in this record has a RING-type zinc finger and a UBR-type zinc finger. Mutations in this gene have been associated with Johanson-Blizzard syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants have 20% lower body weight and reduced muscle and adipose tissue. Skeletal muscle lacks a mechanism for targeting proteins for rapid catabolism. Aberrant regulation of fatty acid synthase upon starvation is also observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik A G 11: 78,285,580 Y1836C probably damaging Het
4930402H24Rik A G 2: 130,748,683 probably null Het
4931408C20Rik T G 1: 26,685,880 K73T possibly damaging Het
Adgrv1 A G 13: 81,579,619 S301P probably damaging Het
AI987944 C A 7: 41,374,530 G342* probably null Het
Alox5 A T 6: 116,424,164 F212I probably damaging Het
Apaf1 A T 10: 91,060,243 D322E probably benign Het
Aste1 T A 9: 105,397,810 Y355* probably null Het
Bloc1s6 T G 2: 122,746,143 probably null Het
Ccdc77 G A 6: 120,338,140 Q183* probably null Het
Ccdc92 T C 5: 124,836,271 T65A probably benign Het
Chrna2 C T 14: 66,143,363 A27V probably benign Het
Coch G T 12: 51,598,289 V209F probably damaging Het
Cops3 G A 11: 59,827,889 T193M possibly damaging Het
Cped1 T C 6: 22,132,388 probably null Het
D6Ertd527e A T 6: 87,111,085 S77C unknown Het
Defb7 A G 8: 19,495,094 probably null Het
Entpd6 T A 2: 150,768,923 probably null Het
Evc2 C T 5: 37,370,556 A303V probably benign Het
Fhod1 T C 8: 105,336,798 probably null Het
Gatsl2 T A 5: 134,137,133 L240Q probably damaging Het
Gcn1l1 T A 5: 115,574,617 F54I probably benign Het
Gm6768 A G 12: 119,261,050 noncoding transcript Het
Gm7104 C A 12: 88,285,563 noncoding transcript Het
Grid1 A T 14: 34,822,583 D37V probably damaging Het
Icam5 G A 9: 21,036,406 A560T probably benign Het
Igf2r A C 17: 12,691,285 I2019S probably damaging Het
Kcnj9 A G 1: 172,326,362 V65A probably benign Het
Kif3b T C 2: 153,322,931 probably null Het
Kmt2a T G 9: 44,826,928 probably benign Het
March6 T A 15: 31,498,693 T153S probably damaging Het
Mcam T A 9: 44,136,763 I72N probably damaging Het
Nkain3 T C 4: 20,484,932 I48M probably damaging Het
Nop58 T A 1: 59,698,345 I107N probably damaging Het
Notch2 A G 3: 98,100,257 H441R probably benign Het
Nr1d1 G A 11: 98,770,361 R360C probably benign Het
Olfr683 A G 7: 105,143,681 I210T probably benign Het
Pclo T C 5: 14,713,779 S4089P unknown Het
Pi4kb A G 3: 94,994,387 E455G probably damaging Het
Piezo1 T C 8: 122,482,049 Y2525C probably damaging Het
Pik3c2a A G 7: 116,417,673 V283A possibly damaging Het
Pramef8 G A 4: 143,417,618 R178Q probably benign Het
Rabgap1l A T 1: 160,733,680 V161E probably benign Het
Rasa2 A G 9: 96,544,348 I815T probably benign Het
Rev1 A T 1: 38,088,572 D202E probably benign Het
Sept14 C T 5: 129,693,054 A193T probably damaging Het
Sh3tc1 T C 5: 35,719,026 S112G probably benign Het
Siah3 T A 14: 75,525,554 Y82N probably benign Het
Slc2a7 T C 4: 150,166,396 S425P probably damaging Het
Slc9a2 C T 1: 40,726,388 L313F probably damaging Het
Smdt1 T C 15: 82,346,232 V50A probably benign Het
Supt3 G A 17: 45,036,720 A197T probably benign Het
Tex10 A G 4: 48,436,492 I742T possibly damaging Het
Tex44 T A 1: 86,427,918 H516Q possibly damaging Het
Tfdp1 T G 8: 13,370,917 D171E probably damaging Het
Trim31 A C 17: 36,898,676 D108A probably damaging Het
Uso1 G A 5: 92,180,563 V340I possibly damaging Het
Utp6 A C 11: 79,948,923 V313G probably damaging Het
Vmn2r107 T C 17: 20,374,847 V554A possibly damaging Het
Xdh C A 17: 73,914,019 E572* probably null Het
Zbtb7c T C 18: 76,136,990 S50P probably damaging Het
Zfp672 A G 11: 58,329,569 probably benign Het
Zzef1 A G 11: 72,900,809 probably null Het
Other mutations in Ubr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Ubr1 APN 2 120875407 missense possibly damaging 0.65
IGL00570:Ubr1 APN 2 120941093 missense possibly damaging 0.93
IGL00990:Ubr1 APN 2 120930872 missense probably damaging 1.00
IGL01124:Ubr1 APN 2 120914905 missense probably benign
IGL01346:Ubr1 APN 2 120873122 critical splice donor site probably null
IGL01368:Ubr1 APN 2 120941131 splice site probably benign
IGL01539:Ubr1 APN 2 120926013 missense possibly damaging 0.79
IGL01862:Ubr1 APN 2 120934342 missense possibly damaging 0.81
IGL01965:Ubr1 APN 2 120875398 missense probably damaging 0.99
IGL01984:Ubr1 APN 2 120921386 missense probably damaging 0.99
IGL02184:Ubr1 APN 2 120900508 missense probably benign 0.00
IGL02208:Ubr1 APN 2 120946349 missense probably benign 0.00
IGL02415:Ubr1 APN 2 120970603 utr 5 prime probably benign
IGL02517:Ubr1 APN 2 120864373 missense possibly damaging 0.69
IGL02614:Ubr1 APN 2 120870979 splice site probably benign
IGL02627:Ubr1 APN 2 120940991 missense probably damaging 1.00
IGL02718:Ubr1 APN 2 120914883 missense probably damaging 1.00
IGL02741:Ubr1 APN 2 120941091 missense probably benign 0.01
IGL02939:Ubr1 APN 2 120881183 critical splice acceptor site probably null
IGL03081:Ubr1 APN 2 120961156 missense possibly damaging 0.83
IGL03310:Ubr1 APN 2 120864417 missense probably damaging 1.00
IGL03370:Ubr1 APN 2 120895160 missense probably benign
I1329:Ubr1 UTSW 2 120934294 splice site probably benign
R0022:Ubr1 UTSW 2 120961173 splice site probably benign
R0345:Ubr1 UTSW 2 120904103 synonymous probably null
R0373:Ubr1 UTSW 2 120946657 missense probably benign 0.01
R0393:Ubr1 UTSW 2 120906946 missense probably damaging 1.00
R0543:Ubr1 UTSW 2 120881093 missense probably damaging 1.00
R0559:Ubr1 UTSW 2 120947883 nonsense probably null
R0723:Ubr1 UTSW 2 120881101 nonsense probably null
R1178:Ubr1 UTSW 2 120926029 nonsense probably null
R1401:Ubr1 UTSW 2 120955644 missense probably benign 0.01
R1572:Ubr1 UTSW 2 120935319 splice site probably benign
R1920:Ubr1 UTSW 2 120930968 missense probably benign 0.11
R1921:Ubr1 UTSW 2 120930968 missense probably benign 0.11
R1997:Ubr1 UTSW 2 120946273 critical splice donor site probably null
R2129:Ubr1 UTSW 2 120942553 missense probably benign 0.35
R2147:Ubr1 UTSW 2 120864330 missense probably damaging 1.00
R2191:Ubr1 UTSW 2 120926047 missense probably damaging 0.96
R2288:Ubr1 UTSW 2 120909482 missense probably damaging 1.00
R3409:Ubr1 UTSW 2 120963448 missense probably benign 0.02
R3930:Ubr1 UTSW 2 120916470 missense probably benign 0.20
R3979:Ubr1 UTSW 2 120862687 missense probably benign 0.11
R4172:Ubr1 UTSW 2 120946622 splice site probably null
R4173:Ubr1 UTSW 2 120946622 splice site probably null
R4174:Ubr1 UTSW 2 120946622 splice site probably null
R4241:Ubr1 UTSW 2 120934386 missense possibly damaging 0.69
R4366:Ubr1 UTSW 2 120970603 utr 5 prime probably benign
R4371:Ubr1 UTSW 2 120895066 splice site probably null
R4449:Ubr1 UTSW 2 120946381 missense possibly damaging 0.84
R4533:Ubr1 UTSW 2 120942482 missense possibly damaging 0.86
R4656:Ubr1 UTSW 2 120926013 missense probably benign 0.35
R4765:Ubr1 UTSW 2 120963442 nonsense probably null
R4928:Ubr1 UTSW 2 120914938 missense probably damaging 1.00
R4987:Ubr1 UTSW 2 120963566 missense probably benign 0.00
R5033:Ubr1 UTSW 2 120911997 critical splice donor site probably null
R5108:Ubr1 UTSW 2 120963422 missense probably benign 0.20
R5118:Ubr1 UTSW 2 120882264 missense probably benign 0.20
R5211:Ubr1 UTSW 2 120893170 missense possibly damaging 0.92
R5215:Ubr1 UTSW 2 120904044 missense probably benign 0.00
R5449:Ubr1 UTSW 2 120963500 missense probably benign
R5452:Ubr1 UTSW 2 120868302 missense possibly damaging 0.95
R5582:Ubr1 UTSW 2 120915407 missense probably benign
R5610:Ubr1 UTSW 2 120892112 missense probably benign 0.04
R5637:Ubr1 UTSW 2 120963517 missense possibly damaging 0.68
R5808:Ubr1 UTSW 2 120961092 missense possibly damaging 0.63
R5845:Ubr1 UTSW 2 120904005 missense probably benign
R5979:Ubr1 UTSW 2 120946382 missense probably benign 0.07
R6044:Ubr1 UTSW 2 120862721 missense probably benign 0.38
R6146:Ubr1 UTSW 2 120893209 missense probably damaging 0.98
R6252:Ubr1 UTSW 2 120906895 missense probably benign 0.21
R6389:Ubr1 UTSW 2 120881039 missense probably benign 0.03
R6600:Ubr1 UTSW 2 120915399 missense probably benign 0.00
R6670:Ubr1 UTSW 2 120924130 critical splice donor site probably null
R6731:Ubr1 UTSW 2 120955640 missense probably null 0.99
R6836:Ubr1 UTSW 2 120896675 intron probably null
Predicted Primers PCR Primer
(F):5'- GCATTGTCTACCATGCTCAGGAGTT -3'
(R):5'- TGTTATTTTGCCCACCACACAGGAA -3'

Sequencing Primer
(F):5'- CTTACAGAGGGTCAAATCTTCCAAG -3'
(R):5'- CAGGAAGCTCATTCGTTTTATAGTTG -3'
Posted On2014-03-28