Incidental Mutation 'R1485:Olfr683'
ID163401
Institutional Source Beutler Lab
Gene Symbol Olfr683
Ensembl Gene ENSMUSG00000044120
Gene Nameolfactory receptor 683
SynonymsGA_x6K02T2PBJ9-7773007-7772066, MOR40-1
MMRRC Submission 039538-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R1485 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location105140839-105147012 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105143681 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 210 (I210T)
Ref Sequence ENSEMBL: ENSMUSP00000060527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061284] [ENSMUST00000209879]
Predicted Effect probably benign
Transcript: ENSMUST00000061284
AA Change: I210T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000060527
Gene: ENSMUSG00000044120
AA Change: I210T

DomainStartEndE-ValueType
Pfam:7tm_4 40 318 8.5e-73 PFAM
Pfam:7TM_GPCR_Srsx 44 315 3.5e-8 PFAM
Pfam:7tm_1 50 300 1.3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209879
AA Change: I204T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211388
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik A G 11: 78,285,580 Y1836C probably damaging Het
4930402H24Rik A G 2: 130,748,683 probably null Het
4931408C20Rik T G 1: 26,685,880 K73T possibly damaging Het
Adgrv1 A G 13: 81,579,619 S301P probably damaging Het
AI987944 C A 7: 41,374,530 G342* probably null Het
Alox5 A T 6: 116,424,164 F212I probably damaging Het
Apaf1 A T 10: 91,060,243 D322E probably benign Het
Aste1 T A 9: 105,397,810 Y355* probably null Het
Bloc1s6 T G 2: 122,746,143 probably null Het
Ccdc77 G A 6: 120,338,140 Q183* probably null Het
Ccdc92 T C 5: 124,836,271 T65A probably benign Het
Chrna2 C T 14: 66,143,363 A27V probably benign Het
Coch G T 12: 51,598,289 V209F probably damaging Het
Cops3 G A 11: 59,827,889 T193M possibly damaging Het
Cped1 T C 6: 22,132,388 probably null Het
D6Ertd527e A T 6: 87,111,085 S77C unknown Het
Defb7 A G 8: 19,495,094 probably null Het
Entpd6 T A 2: 150,768,923 probably null Het
Evc2 C T 5: 37,370,556 A303V probably benign Het
Fhod1 T C 8: 105,336,798 probably null Het
Gatsl2 T A 5: 134,137,133 L240Q probably damaging Het
Gcn1l1 T A 5: 115,574,617 F54I probably benign Het
Gm6768 A G 12: 119,261,050 noncoding transcript Het
Gm7104 C A 12: 88,285,563 noncoding transcript Het
Grid1 A T 14: 34,822,583 D37V probably damaging Het
Icam5 G A 9: 21,036,406 A560T probably benign Het
Igf2r A C 17: 12,691,285 I2019S probably damaging Het
Kcnj9 A G 1: 172,326,362 V65A probably benign Het
Kif3b T C 2: 153,322,931 probably null Het
Kmt2a T G 9: 44,826,928 probably benign Het
March6 T A 15: 31,498,693 T153S probably damaging Het
Mcam T A 9: 44,136,763 I72N probably damaging Het
Nkain3 T C 4: 20,484,932 I48M probably damaging Het
Nop58 T A 1: 59,698,345 I107N probably damaging Het
Notch2 A G 3: 98,100,257 H441R probably benign Het
Nr1d1 G A 11: 98,770,361 R360C probably benign Het
Pclo T C 5: 14,713,779 S4089P unknown Het
Pi4kb A G 3: 94,994,387 E455G probably damaging Het
Piezo1 T C 8: 122,482,049 Y2525C probably damaging Het
Pik3c2a A G 7: 116,417,673 V283A possibly damaging Het
Pramef8 G A 4: 143,417,618 R178Q probably benign Het
Rabgap1l A T 1: 160,733,680 V161E probably benign Het
Rasa2 A G 9: 96,544,348 I815T probably benign Het
Rev1 A T 1: 38,088,572 D202E probably benign Het
Sept14 C T 5: 129,693,054 A193T probably damaging Het
Sh3tc1 T C 5: 35,719,026 S112G probably benign Het
Siah3 T A 14: 75,525,554 Y82N probably benign Het
Slc2a7 T C 4: 150,166,396 S425P probably damaging Het
Slc9a2 C T 1: 40,726,388 L313F probably damaging Het
Smdt1 T C 15: 82,346,232 V50A probably benign Het
Supt3 G A 17: 45,036,720 A197T probably benign Het
Tex10 A G 4: 48,436,492 I742T possibly damaging Het
Tex44 T A 1: 86,427,918 H516Q possibly damaging Het
Tfdp1 T G 8: 13,370,917 D171E probably damaging Het
Trim31 A C 17: 36,898,676 D108A probably damaging Het
Ubr1 T C 2: 120,961,098 N135S probably benign Het
Uso1 G A 5: 92,180,563 V340I possibly damaging Het
Utp6 A C 11: 79,948,923 V313G probably damaging Het
Vmn2r107 T C 17: 20,374,847 V554A possibly damaging Het
Xdh C A 17: 73,914,019 E572* probably null Het
Zbtb7c T C 18: 76,136,990 S50P probably damaging Het
Zfp672 A G 11: 58,329,569 probably benign Het
Zzef1 A G 11: 72,900,809 probably null Het
Other mutations in Olfr683
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01814:Olfr683 APN 7 105143604 missense possibly damaging 0.48
IGL01984:Olfr683 APN 7 105143716 missense probably benign 0.00
IGL02456:Olfr683 APN 7 105143759 missense probably damaging 0.99
IGL03242:Olfr683 APN 7 105144266 missense probably benign 0.00
R0234:Olfr683 UTSW 7 105144074 missense probably damaging 1.00
R0234:Olfr683 UTSW 7 105144074 missense probably damaging 1.00
R1282:Olfr683 UTSW 7 105143652 missense probably benign 0.01
R1653:Olfr683 UTSW 7 105143870 missense possibly damaging 0.80
R2130:Olfr683 UTSW 7 105143550 missense probably benign 0.03
R2355:Olfr683 UTSW 7 105143813 missense probably benign 0.11
R4491:Olfr683 UTSW 7 105143776 nonsense probably null
R4826:Olfr683 UTSW 7 105143968 missense probably damaging 0.99
R4980:Olfr683 UTSW 7 105144224 missense probably benign
R5934:Olfr683 UTSW 7 105143660 missense probably benign 0.12
R6354:Olfr683 UTSW 7 105143708 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AGCACCAGCAAGACTGTGCTGAAG -3'
(R):5'- AGTTTCCTGACGATGGAGTCCTGC -3'

Sequencing Primer
(F):5'- ACTGTGCTGAAGAAGAGGATG -3'
(R):5'- CATGGCTTATGACCGCTATGTG -3'
Posted On2014-03-28