Incidental Mutation 'R1485:Pik3c2a'
ID163402
Institutional Source Beutler Lab
Gene Symbol Pik3c2a
Ensembl Gene ENSMUSG00000030660
Gene Namephosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha
SynonymsPI3KC2
MMRRC Submission 039538-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.807) question?
Stock #R1485 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location116337265-116443449 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116417673 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 283 (V283A)
Ref Sequence ENSEMBL: ENSMUSP00000145572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170430] [ENSMUST00000205378] [ENSMUST00000206219]
Predicted Effect probably benign
Transcript: ENSMUST00000170430
AA Change: V283A

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000126092
Gene: ENSMUSG00000030660
AA Change: V283A

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
low complexity region 361 372 N/A INTRINSIC
PI3K_rbd 410 513 3.08e-38 SMART
PI3K_C2 674 783 2.71e-34 SMART
PI3Ka 860 1047 3.62e-85 SMART
PI3Kc 1134 1396 3.1e-125 SMART
PX 1422 1534 5.68e-30 SMART
C2 1573 1677 3.93e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000205378
AA Change: V283A

PolyPhen 2 Score 0.503 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205767
Predicted Effect probably benign
Transcript: ENSMUST00000206219
AA Change: V283A

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. The PI3-kinase activity of this protein is not sensitive to nanomolar levels of the inhibitor wortmanin. This protein was shown to be able to be activated by insulin and may be involved in integrin-dependent signaling. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele show chronic renal failure and a range of renal lesions that precede immune involvement. Mice heterozygous for a kinase-inactivating allele show defects in platelet formation, platelet membrane morphology and dynamics, and an enrichment of barbell proplatelets. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik A G 11: 78,285,580 Y1836C probably damaging Het
4930402H24Rik A G 2: 130,748,683 probably null Het
4931408C20Rik T G 1: 26,685,880 K73T possibly damaging Het
Adgrv1 A G 13: 81,579,619 S301P probably damaging Het
AI987944 C A 7: 41,374,530 G342* probably null Het
Alox5 A T 6: 116,424,164 F212I probably damaging Het
Apaf1 A T 10: 91,060,243 D322E probably benign Het
Aste1 T A 9: 105,397,810 Y355* probably null Het
Bloc1s6 T G 2: 122,746,143 probably null Het
Ccdc77 G A 6: 120,338,140 Q183* probably null Het
Ccdc92 T C 5: 124,836,271 T65A probably benign Het
Chrna2 C T 14: 66,143,363 A27V probably benign Het
Coch G T 12: 51,598,289 V209F probably damaging Het
Cops3 G A 11: 59,827,889 T193M possibly damaging Het
Cped1 T C 6: 22,132,388 probably null Het
D6Ertd527e A T 6: 87,111,085 S77C unknown Het
Defb7 A G 8: 19,495,094 probably null Het
Entpd6 T A 2: 150,768,923 probably null Het
Evc2 C T 5: 37,370,556 A303V probably benign Het
Fhod1 T C 8: 105,336,798 probably null Het
Gatsl2 T A 5: 134,137,133 L240Q probably damaging Het
Gcn1l1 T A 5: 115,574,617 F54I probably benign Het
Gm6768 A G 12: 119,261,050 noncoding transcript Het
Gm7104 C A 12: 88,285,563 noncoding transcript Het
Grid1 A T 14: 34,822,583 D37V probably damaging Het
Icam5 G A 9: 21,036,406 A560T probably benign Het
Igf2r A C 17: 12,691,285 I2019S probably damaging Het
Kcnj9 A G 1: 172,326,362 V65A probably benign Het
Kif3b T C 2: 153,322,931 probably null Het
Kmt2a T G 9: 44,826,928 probably benign Het
March6 T A 15: 31,498,693 T153S probably damaging Het
Mcam T A 9: 44,136,763 I72N probably damaging Het
Nkain3 T C 4: 20,484,932 I48M probably damaging Het
Nop58 T A 1: 59,698,345 I107N probably damaging Het
Notch2 A G 3: 98,100,257 H441R probably benign Het
Nr1d1 G A 11: 98,770,361 R360C probably benign Het
Olfr683 A G 7: 105,143,681 I210T probably benign Het
Pclo T C 5: 14,713,779 S4089P unknown Het
Pi4kb A G 3: 94,994,387 E455G probably damaging Het
Piezo1 T C 8: 122,482,049 Y2525C probably damaging Het
Pramef8 G A 4: 143,417,618 R178Q probably benign Het
Rabgap1l A T 1: 160,733,680 V161E probably benign Het
Rasa2 A G 9: 96,544,348 I815T probably benign Het
Rev1 A T 1: 38,088,572 D202E probably benign Het
Sept14 C T 5: 129,693,054 A193T probably damaging Het
Sh3tc1 T C 5: 35,719,026 S112G probably benign Het
Siah3 T A 14: 75,525,554 Y82N probably benign Het
Slc2a7 T C 4: 150,166,396 S425P probably damaging Het
Slc9a2 C T 1: 40,726,388 L313F probably damaging Het
Smdt1 T C 15: 82,346,232 V50A probably benign Het
Supt3 G A 17: 45,036,720 A197T probably benign Het
Tex10 A G 4: 48,436,492 I742T possibly damaging Het
Tex44 T A 1: 86,427,918 H516Q possibly damaging Het
Tfdp1 T G 8: 13,370,917 D171E probably damaging Het
Trim31 A C 17: 36,898,676 D108A probably damaging Het
Ubr1 T C 2: 120,961,098 N135S probably benign Het
Uso1 G A 5: 92,180,563 V340I possibly damaging Het
Utp6 A C 11: 79,948,923 V313G probably damaging Het
Vmn2r107 T C 17: 20,374,847 V554A possibly damaging Het
Xdh C A 17: 73,914,019 E572* probably null Het
Zbtb7c T C 18: 76,136,990 S50P probably damaging Het
Zfp672 A G 11: 58,329,569 probably benign Het
Zzef1 A G 11: 72,900,809 probably null Het
Other mutations in Pik3c2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Pik3c2a APN 7 116376283 missense possibly damaging 0.50
IGL00732:Pik3c2a APN 7 116364500 missense possibly damaging 0.82
IGL01303:Pik3c2a APN 7 116373803 missense possibly damaging 0.94
IGL01443:Pik3c2a APN 7 116418194 missense probably benign 0.01
IGL01462:Pik3c2a APN 7 116376250 missense possibly damaging 0.94
IGL01641:Pik3c2a APN 7 116350765 intron probably benign
IGL01695:Pik3c2a APN 7 116417518 missense possibly damaging 0.82
IGL02095:Pik3c2a APN 7 116346188 missense probably damaging 1.00
IGL02137:Pik3c2a APN 7 116350804 missense probably benign 0.00
IGL02160:Pik3c2a APN 7 116388064 missense probably damaging 1.00
IGL02224:Pik3c2a APN 7 116363340 splice site probably benign
IGL02345:Pik3c2a APN 7 116405891 missense probably damaging 1.00
IGL02644:Pik3c2a APN 7 116372814 missense probably benign 0.00
IGL02756:Pik3c2a APN 7 116364513 missense probably benign 0.01
IGL03339:Pik3c2a APN 7 116418021 missense possibly damaging 0.57
IGL03412:Pik3c2a APN 7 116417839 missense probably benign 0.21
R0046:Pik3c2a UTSW 7 116354072 missense probably damaging 1.00
R0387:Pik3c2a UTSW 7 116373744 missense probably damaging 1.00
R0501:Pik3c2a UTSW 7 116354055 missense probably damaging 1.00
R0650:Pik3c2a UTSW 7 116346247 splice site probably benign
R0991:Pik3c2a UTSW 7 116362045 critical splice donor site probably null
R1074:Pik3c2a UTSW 7 116350925 nonsense probably null
R1495:Pik3c2a UTSW 7 116388065 missense probably benign 0.01
R1510:Pik3c2a UTSW 7 116388045 missense probably benign 0.00
R1654:Pik3c2a UTSW 7 116368848 missense probably benign 0.02
R1711:Pik3c2a UTSW 7 116417927 nonsense probably null
R1733:Pik3c2a UTSW 7 116418520 start codon destroyed possibly damaging 0.96
R1751:Pik3c2a UTSW 7 116346236 missense probably damaging 0.98
R1812:Pik3c2a UTSW 7 116417664 missense probably damaging 0.98
R1817:Pik3c2a UTSW 7 116376512 critical splice donor site probably null
R1826:Pik3c2a UTSW 7 116368117 missense probably benign
R1875:Pik3c2a UTSW 7 116417971 missense probably benign 0.35
R1995:Pik3c2a UTSW 7 116354006 missense probably damaging 1.00
R2007:Pik3c2a UTSW 7 116342237 missense probably damaging 1.00
R2009:Pik3c2a UTSW 7 116364503 missense probably damaging 1.00
R2013:Pik3c2a UTSW 7 116350931 critical splice acceptor site probably null
R2014:Pik3c2a UTSW 7 116350931 critical splice acceptor site probably null
R2015:Pik3c2a UTSW 7 116350931 critical splice acceptor site probably null
R2027:Pik3c2a UTSW 7 116350822 missense probably damaging 1.00
R2050:Pik3c2a UTSW 7 116417451 critical splice donor site probably null
R2068:Pik3c2a UTSW 7 116372891 nonsense probably null
R3814:Pik3c2a UTSW 7 116348179 missense probably damaging 1.00
R3848:Pik3c2a UTSW 7 116364550 nonsense probably null
R4386:Pik3c2a UTSW 7 116354099 missense probably damaging 1.00
R4668:Pik3c2a UTSW 7 116358688 missense probably benign 0.16
R4783:Pik3c2a UTSW 7 116417825 missense probably damaging 1.00
R4860:Pik3c2a UTSW 7 116340156 missense probably damaging 1.00
R4860:Pik3c2a UTSW 7 116340156 missense probably damaging 1.00
R5057:Pik3c2a UTSW 7 116376283 missense possibly damaging 0.50
R5080:Pik3c2a UTSW 7 116348274 missense probably damaging 1.00
R5083:Pik3c2a UTSW 7 116342401 missense probably damaging 1.00
R5144:Pik3c2a UTSW 7 116350786 missense probably benign 0.01
R5589:Pik3c2a UTSW 7 116417658 missense probably benign 0.02
R5646:Pik3c2a UTSW 7 116405951 missense probably damaging 1.00
R5829:Pik3c2a UTSW 7 116372814 missense probably benign 0.00
R5951:Pik3c2a UTSW 7 116368184 missense probably damaging 0.96
R5958:Pik3c2a UTSW 7 116362564 missense probably damaging 1.00
R6356:Pik3c2a UTSW 7 116348205 missense possibly damaging 0.46
R6551:Pik3c2a UTSW 7 116417496 missense probably damaging 0.97
R6641:Pik3c2a UTSW 7 116340225 critical splice acceptor site probably null
R6661:Pik3c2a UTSW 7 116368758 missense possibly damaging 0.77
R6789:Pik3c2a UTSW 7 116362184 missense probably damaging 1.00
R6874:Pik3c2a UTSW 7 116394305 missense probably damaging 1.00
R6985:Pik3c2a UTSW 7 116417988 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGCTTCTTGTTACAGTTGCCCCAG -3'
(R):5'- TCAGTCCAAGGATGCCCACTTTTC -3'

Sequencing Primer
(F):5'- TGTTACAGTTGCCCCAGAAAGG -3'
(R):5'- AGGAAGTTTACCAGTCTATCGGC -3'
Posted On2014-03-28