Incidental Mutation 'R1485:Tfdp1'
ID163403
Institutional Source Beutler Lab
Gene Symbol Tfdp1
Ensembl Gene ENSMUSG00000038482
Gene Nametranscription factor Dp 1
SynonymsDrtf1, Dp1
MMRRC Submission 039538-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1485 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location13338751-13378448 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 13370917 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 171 (D171E)
Ref Sequence ENSEMBL: ENSMUSP00000147881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170909] [ENSMUST00000209282] [ENSMUST00000209396] [ENSMUST00000209885] [ENSMUST00000209945] [ENSMUST00000210165] [ENSMUST00000210501]
Predicted Effect probably damaging
Transcript: ENSMUST00000170909
AA Change: D171E

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000127952
Gene: ENSMUSG00000038482
AA Change: D171E

DomainStartEndE-ValueType
E2F_TDP 111 193 1.51e-34 SMART
DP 200 344 4.07e-90 SMART
low complexity region 395 410 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209282
Predicted Effect possibly damaging
Transcript: ENSMUST00000209396
AA Change: D51E

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably damaging
Transcript: ENSMUST00000209885
AA Change: D171E

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000209945
Predicted Effect possibly damaging
Transcript: ENSMUST00000210165
AA Change: D113E

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000210501
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210518
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211606
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of transcription factors that heterodimerize with E2F proteins to enhance their DNA-binding activity and promote transcription from E2F target genes. The encoded protein functions as part of this complex to control the transcriptional activity of numerous genes involved in cell cycle progression from G1 to S phase. Alternative splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 1, 15, and X.[provided by RefSeq, Jan 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced expansion of the ectoplacental cone and chorion, small yolk sacs, and impaired endoreduplication in trophoblast giant cells. Mutants die by embryonic day 12.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik A G 11: 78,285,580 Y1836C probably damaging Het
4930402H24Rik A G 2: 130,748,683 probably null Het
4931408C20Rik T G 1: 26,685,880 K73T possibly damaging Het
Adgrv1 A G 13: 81,579,619 S301P probably damaging Het
AI987944 C A 7: 41,374,530 G342* probably null Het
Alox5 A T 6: 116,424,164 F212I probably damaging Het
Apaf1 A T 10: 91,060,243 D322E probably benign Het
Aste1 T A 9: 105,397,810 Y355* probably null Het
Bloc1s6 T G 2: 122,746,143 probably null Het
Ccdc77 G A 6: 120,338,140 Q183* probably null Het
Ccdc92 T C 5: 124,836,271 T65A probably benign Het
Chrna2 C T 14: 66,143,363 A27V probably benign Het
Coch G T 12: 51,598,289 V209F probably damaging Het
Cops3 G A 11: 59,827,889 T193M possibly damaging Het
Cped1 T C 6: 22,132,388 probably null Het
D6Ertd527e A T 6: 87,111,085 S77C unknown Het
Defb7 A G 8: 19,495,094 probably null Het
Entpd6 T A 2: 150,768,923 probably null Het
Evc2 C T 5: 37,370,556 A303V probably benign Het
Fhod1 T C 8: 105,336,798 probably null Het
Gatsl2 T A 5: 134,137,133 L240Q probably damaging Het
Gcn1l1 T A 5: 115,574,617 F54I probably benign Het
Gm6768 A G 12: 119,261,050 noncoding transcript Het
Gm7104 C A 12: 88,285,563 noncoding transcript Het
Grid1 A T 14: 34,822,583 D37V probably damaging Het
Icam5 G A 9: 21,036,406 A560T probably benign Het
Igf2r A C 17: 12,691,285 I2019S probably damaging Het
Kcnj9 A G 1: 172,326,362 V65A probably benign Het
Kif3b T C 2: 153,322,931 probably null Het
Kmt2a T G 9: 44,826,928 probably benign Het
March6 T A 15: 31,498,693 T153S probably damaging Het
Mcam T A 9: 44,136,763 I72N probably damaging Het
Nkain3 T C 4: 20,484,932 I48M probably damaging Het
Nop58 T A 1: 59,698,345 I107N probably damaging Het
Notch2 A G 3: 98,100,257 H441R probably benign Het
Nr1d1 G A 11: 98,770,361 R360C probably benign Het
Olfr683 A G 7: 105,143,681 I210T probably benign Het
Pclo T C 5: 14,713,779 S4089P unknown Het
Pi4kb A G 3: 94,994,387 E455G probably damaging Het
Piezo1 T C 8: 122,482,049 Y2525C probably damaging Het
Pik3c2a A G 7: 116,417,673 V283A possibly damaging Het
Pramef8 G A 4: 143,417,618 R178Q probably benign Het
Rabgap1l A T 1: 160,733,680 V161E probably benign Het
Rasa2 A G 9: 96,544,348 I815T probably benign Het
Rev1 A T 1: 38,088,572 D202E probably benign Het
Sept14 C T 5: 129,693,054 A193T probably damaging Het
Sh3tc1 T C 5: 35,719,026 S112G probably benign Het
Siah3 T A 14: 75,525,554 Y82N probably benign Het
Slc2a7 T C 4: 150,166,396 S425P probably damaging Het
Slc9a2 C T 1: 40,726,388 L313F probably damaging Het
Smdt1 T C 15: 82,346,232 V50A probably benign Het
Supt3 G A 17: 45,036,720 A197T probably benign Het
Tex10 A G 4: 48,436,492 I742T possibly damaging Het
Tex44 T A 1: 86,427,918 H516Q possibly damaging Het
Trim31 A C 17: 36,898,676 D108A probably damaging Het
Ubr1 T C 2: 120,961,098 N135S probably benign Het
Uso1 G A 5: 92,180,563 V340I possibly damaging Het
Utp6 A C 11: 79,948,923 V313G probably damaging Het
Vmn2r107 T C 17: 20,374,847 V554A possibly damaging Het
Xdh C A 17: 73,914,019 E572* probably null Het
Zbtb7c T C 18: 76,136,990 S50P probably damaging Het
Zfp672 A G 11: 58,329,569 probably benign Het
Zzef1 A G 11: 72,900,809 probably null Het
Other mutations in Tfdp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02558:Tfdp1 APN 8 13369546 missense possibly damaging 0.95
gangly UTSW 8 13357038 splice site probably null
PIT1430001:Tfdp1 UTSW 8 13372526 missense probably benign 0.35
R1139:Tfdp1 UTSW 8 13373000 missense probably benign 0.14
R1264:Tfdp1 UTSW 8 13373837 splice site probably benign
R1967:Tfdp1 UTSW 8 13373039 missense possibly damaging 0.59
R4849:Tfdp1 UTSW 8 13373895 missense probably benign
R4965:Tfdp1 UTSW 8 13373073 missense probably damaging 0.99
R5257:Tfdp1 UTSW 8 13369529 missense possibly damaging 0.92
R5258:Tfdp1 UTSW 8 13369529 missense possibly damaging 0.92
R5895:Tfdp1 UTSW 8 13357038 splice site probably null
R6785:Tfdp1 UTSW 8 13370485 missense probably damaging 0.99
R6785:Tfdp1 UTSW 8 13377233 missense possibly damaging 0.85
R6786:Tfdp1 UTSW 8 13370485 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTCTGGCAAGACATGGGGCTTGAC -3'
(R):5'- CTCAAGTGACCAAGGACAATGGACG -3'

Sequencing Primer
(F):5'- CCACTCAGTATAGCGTGGTTCAG -3'
(R):5'- ACAATGGACGCCTGCTTAG -3'
Posted On2014-03-28