Incidental Mutation 'R1485:Icam5'
ID163407
Institutional Source Beutler Lab
Gene Symbol Icam5
Ensembl Gene ENSMUSG00000032174
Gene Nameintercellular adhesion molecule 5, telencephalin
SynonymsTlcn, TLN, Icam3, CD50
MMRRC Submission 039538-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1485 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location21032073-21039036 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 21036406 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 560 (A560T)
Ref Sequence ENSEMBL: ENSMUSP00000019616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019616]
Predicted Effect probably benign
Transcript: ENSMUST00000019616
AA Change: A560T

PolyPhen 2 Score 0.342 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000019616
Gene: ENSMUSG00000032174
AA Change: A560T

DomainStartEndE-ValueType
transmembrane domain 12 31 N/A INTRINSIC
Pfam:ICAM_N 32 122 1.5e-17 PFAM
Pfam:Ig_3 121 202 5.6e-4 PFAM
low complexity region 284 292 N/A INTRINSIC
IG_like 329 405 1.45e1 SMART
IG 416 488 1.72e-2 SMART
IG 499 569 5.84e-5 SMART
IG_like 580 662 3.57e1 SMART
IG 673 742 3.49e-3 SMART
IGc2 758 819 1.97e-11 SMART
transmembrane domain 833 855 N/A INTRINSIC
low complexity region 884 902 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122714
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180870
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216917
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the intercellular adhesion molecule (ICAM) family. All ICAM proteins are type I transmembrane glycoproteins, contain 2-9 immunoglobulin-like C2-type domains, and bind to the leukocyte adhesion LFA-1 protein. This protein is expressed on the surface of telencephalic neurons and displays two types of adhesion activity, homophilic binding between neurons and heterophilic binding between neurons and leukocytes. It may be a critical component in neuron-microglial cell interactions in the course of normal development or as part of neurodegenerative diseases. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice exhibit enhanced long-term potentiation, sensorimotor gating, and reward-based learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik A G 11: 78,285,580 Y1836C probably damaging Het
4930402H24Rik A G 2: 130,748,683 probably null Het
4931408C20Rik T G 1: 26,685,880 K73T possibly damaging Het
Adgrv1 A G 13: 81,579,619 S301P probably damaging Het
AI987944 C A 7: 41,374,530 G342* probably null Het
Alox5 A T 6: 116,424,164 F212I probably damaging Het
Apaf1 A T 10: 91,060,243 D322E probably benign Het
Aste1 T A 9: 105,397,810 Y355* probably null Het
Bloc1s6 T G 2: 122,746,143 probably null Het
Ccdc77 G A 6: 120,338,140 Q183* probably null Het
Ccdc92 T C 5: 124,836,271 T65A probably benign Het
Chrna2 C T 14: 66,143,363 A27V probably benign Het
Coch G T 12: 51,598,289 V209F probably damaging Het
Cops3 G A 11: 59,827,889 T193M possibly damaging Het
Cped1 T C 6: 22,132,388 probably null Het
D6Ertd527e A T 6: 87,111,085 S77C unknown Het
Defb7 A G 8: 19,495,094 probably null Het
Entpd6 T A 2: 150,768,923 probably null Het
Evc2 C T 5: 37,370,556 A303V probably benign Het
Fhod1 T C 8: 105,336,798 probably null Het
Gatsl2 T A 5: 134,137,133 L240Q probably damaging Het
Gcn1l1 T A 5: 115,574,617 F54I probably benign Het
Gm6768 A G 12: 119,261,050 noncoding transcript Het
Gm7104 C A 12: 88,285,563 noncoding transcript Het
Grid1 A T 14: 34,822,583 D37V probably damaging Het
Igf2r A C 17: 12,691,285 I2019S probably damaging Het
Kcnj9 A G 1: 172,326,362 V65A probably benign Het
Kif3b T C 2: 153,322,931 probably null Het
Kmt2a T G 9: 44,826,928 probably benign Het
March6 T A 15: 31,498,693 T153S probably damaging Het
Mcam T A 9: 44,136,763 I72N probably damaging Het
Nkain3 T C 4: 20,484,932 I48M probably damaging Het
Nop58 T A 1: 59,698,345 I107N probably damaging Het
Notch2 A G 3: 98,100,257 H441R probably benign Het
Nr1d1 G A 11: 98,770,361 R360C probably benign Het
Olfr683 A G 7: 105,143,681 I210T probably benign Het
Pclo T C 5: 14,713,779 S4089P unknown Het
Pi4kb A G 3: 94,994,387 E455G probably damaging Het
Piezo1 T C 8: 122,482,049 Y2525C probably damaging Het
Pik3c2a A G 7: 116,417,673 V283A possibly damaging Het
Pramef8 G A 4: 143,417,618 R178Q probably benign Het
Rabgap1l A T 1: 160,733,680 V161E probably benign Het
Rasa2 A G 9: 96,544,348 I815T probably benign Het
Rev1 A T 1: 38,088,572 D202E probably benign Het
Sept14 C T 5: 129,693,054 A193T probably damaging Het
Sh3tc1 T C 5: 35,719,026 S112G probably benign Het
Siah3 T A 14: 75,525,554 Y82N probably benign Het
Slc2a7 T C 4: 150,166,396 S425P probably damaging Het
Slc9a2 C T 1: 40,726,388 L313F probably damaging Het
Smdt1 T C 15: 82,346,232 V50A probably benign Het
Supt3 G A 17: 45,036,720 A197T probably benign Het
Tex10 A G 4: 48,436,492 I742T possibly damaging Het
Tex44 T A 1: 86,427,918 H516Q possibly damaging Het
Tfdp1 T G 8: 13,370,917 D171E probably damaging Het
Trim31 A C 17: 36,898,676 D108A probably damaging Het
Ubr1 T C 2: 120,961,098 N135S probably benign Het
Uso1 G A 5: 92,180,563 V340I possibly damaging Het
Utp6 A C 11: 79,948,923 V313G probably damaging Het
Vmn2r107 T C 17: 20,374,847 V554A possibly damaging Het
Xdh C A 17: 73,914,019 E572* probably null Het
Zbtb7c T C 18: 76,136,990 S50P probably damaging Het
Zfp672 A G 11: 58,329,569 probably benign Het
Zzef1 A G 11: 72,900,809 probably null Het
Other mutations in Icam5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Icam5 APN 9 21036795 critical splice donor site probably null
IGL00972:Icam5 APN 9 21034697 missense probably damaging 0.99
IGL01690:Icam5 APN 9 21034799 missense possibly damaging 0.69
IGL02334:Icam5 APN 9 21035209 missense possibly damaging 0.92
IGL03387:Icam5 APN 9 21033801 missense probably benign 0.10
H8562:Icam5 UTSW 9 21035146 missense probably benign 0.04
R0002:Icam5 UTSW 9 21033505 missense probably benign 0.00
R0594:Icam5 UTSW 9 21035598 missense probably benign 0.11
R0605:Icam5 UTSW 9 21032197 missense probably benign 0.23
R1773:Icam5 UTSW 9 21033525 missense possibly damaging 0.67
R1934:Icam5 UTSW 9 21034786 missense probably benign 0.32
R3125:Icam5 UTSW 9 21036658 missense probably benign 0.00
R4117:Icam5 UTSW 9 21037590 missense probably damaging 0.99
R4132:Icam5 UTSW 9 21036657 missense probably benign
R4250:Icam5 UTSW 9 21037739 missense probably damaging 0.98
R4470:Icam5 UTSW 9 21035506 nonsense probably null
R4471:Icam5 UTSW 9 21035506 nonsense probably null
R4826:Icam5 UTSW 9 21037803 missense possibly damaging 0.67
R5182:Icam5 UTSW 9 21034810 missense probably benign
R5586:Icam5 UTSW 9 21034820 missense probably damaging 0.98
R6200:Icam5 UTSW 9 21038749 missense probably damaging 1.00
R6240:Icam5 UTSW 9 21033158 missense possibly damaging 0.80
R6291:Icam5 UTSW 9 21036921 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- AGCTGTCTCCCGAAGGCATAGAAC -3'
(R):5'- TTGAGGACACCAAGGGCAACAC -3'

Sequencing Primer
(F):5'- taggcaaaggcaggcac -3'
(R):5'- GGGCAACACTATCCCTTCG -3'
Posted On2014-03-28