Incidental Mutation 'R1485:Aste1'
ID163411
Institutional Source Beutler Lab
Gene Symbol Aste1
Ensembl Gene ENSMUSG00000032567
Gene Nameasteroid homolog 1
Synonyms1100001A21Rik
MMRRC Submission 039538-MU
Accession Numbers

Ncbi RefSeq: NM_025651.4, NM_001164828.1; MGI:1913845

Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R1485 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location105395392-105412229 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 105397810 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 355 (Y355*)
Ref Sequence ENSEMBL: ENSMUSP00000149596 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035181] [ENSMUST00000038648] [ENSMUST00000123807] [ENSMUST00000140851] [ENSMUST00000156256] [ENSMUST00000167674] [ENSMUST00000176350] [ENSMUST00000176940] [ENSMUST00000177029] [ENSMUST00000177402] [ENSMUST00000189758]
Predicted Effect probably null
Transcript: ENSMUST00000035181
AA Change: Y416*
SMART Domains Protein: ENSMUSP00000035181
Gene: ENSMUSG00000032567
AA Change: Y416*

DomainStartEndE-ValueType
Pfam:XPG_I_2 115 307 1e-18 PFAM
low complexity region 476 488 N/A INTRINSIC
low complexity region 621 634 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000038648
SMART Domains Protein: ENSMUSP00000038611
Gene: ENSMUSG00000035032

DomainStartEndE-ValueType
S_TKc 30 288 3.87e-80 SMART
coiled coil region 348 384 N/A INTRINSIC
low complexity region 408 423 N/A INTRINSIC
low complexity region 450 466 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000123807
AA Change: Y355*
Predicted Effect probably null
Transcript: ENSMUST00000123807
AA Change: Y355*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137208
Predicted Effect probably benign
Transcript: ENSMUST00000140851
SMART Domains Protein: ENSMUSP00000116864
Gene: ENSMUSG00000035032

DomainStartEndE-ValueType
S_TKc 30 288 3.87e-80 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156256
SMART Domains Protein: ENSMUSP00000116761
Gene: ENSMUSG00000035032

DomainStartEndE-ValueType
Pfam:Pkinase 30 177 8.9e-36 PFAM
Pfam:Pkinase_Tyr 30 178 8.9e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167674
SMART Domains Protein: ENSMUSP00000131164
Gene: ENSMUSG00000032567

DomainStartEndE-ValueType
low complexity region 108 121 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176350
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176597
Predicted Effect probably benign
Transcript: ENSMUST00000176940
Predicted Effect probably benign
Transcript: ENSMUST00000177029
SMART Domains Protein: ENSMUSP00000135837
Gene: ENSMUSG00000035032

DomainStartEndE-ValueType
SCOP:d1h8fa_ 11 80 1e-6 SMART
Blast:S_TKc 30 70 1e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000177402
SMART Domains Protein: ENSMUSP00000135318
Gene: ENSMUSG00000032567

DomainStartEndE-ValueType
low complexity region 59 71 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189758
SMART Domains Protein: ENSMUSP00000139854
Gene: ENSMUSG00000032567

DomainStartEndE-ValueType
low complexity region 59 71 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.5%
Validation Efficiency
Allele List at MGI

All alleles(6) : Targeted(4) Gene trapped(2)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik A G 11: 78,285,580 Y1836C probably damaging Het
4930402H24Rik A G 2: 130,748,683 probably null Het
4931408C20Rik T G 1: 26,685,880 K73T possibly damaging Het
Adgrv1 A G 13: 81,579,619 S301P probably damaging Het
AI987944 C A 7: 41,374,530 G342* probably null Het
Alox5 A T 6: 116,424,164 F212I probably damaging Het
Apaf1 A T 10: 91,060,243 D322E probably benign Het
Bloc1s6 T G 2: 122,746,143 probably null Het
Ccdc77 G A 6: 120,338,140 Q183* probably null Het
Ccdc92 T C 5: 124,836,271 T65A probably benign Het
Chrna2 C T 14: 66,143,363 A27V probably benign Het
Coch G T 12: 51,598,289 V209F probably damaging Het
Cops3 G A 11: 59,827,889 T193M possibly damaging Het
Cped1 T C 6: 22,132,388 probably null Het
D6Ertd527e A T 6: 87,111,085 S77C unknown Het
Defb7 A G 8: 19,495,094 probably null Het
Entpd6 T A 2: 150,768,923 probably null Het
Evc2 C T 5: 37,370,556 A303V probably benign Het
Fhod1 T C 8: 105,336,798 probably null Het
Gatsl2 T A 5: 134,137,133 L240Q probably damaging Het
Gcn1l1 T A 5: 115,574,617 F54I probably benign Het
Gm6768 A G 12: 119,261,050 noncoding transcript Het
Gm7104 C A 12: 88,285,563 noncoding transcript Het
Grid1 A T 14: 34,822,583 D37V probably damaging Het
Icam5 G A 9: 21,036,406 A560T probably benign Het
Igf2r A C 17: 12,691,285 I2019S probably damaging Het
Kcnj9 A G 1: 172,326,362 V65A probably benign Het
Kif3b T C 2: 153,322,931 probably null Het
Kmt2a T G 9: 44,826,928 probably benign Het
March6 T A 15: 31,498,693 T153S probably damaging Het
Mcam T A 9: 44,136,763 I72N probably damaging Het
Nkain3 T C 4: 20,484,932 I48M probably damaging Het
Nop58 T A 1: 59,698,345 I107N probably damaging Het
Notch2 A G 3: 98,100,257 H441R probably benign Het
Nr1d1 G A 11: 98,770,361 R360C probably benign Het
Olfr683 A G 7: 105,143,681 I210T probably benign Het
Pclo T C 5: 14,713,779 S4089P unknown Het
Pi4kb A G 3: 94,994,387 E455G probably damaging Het
Piezo1 T C 8: 122,482,049 Y2525C probably damaging Het
Pik3c2a A G 7: 116,417,673 V283A possibly damaging Het
Pramef8 G A 4: 143,417,618 R178Q probably benign Het
Rabgap1l A T 1: 160,733,680 V161E probably benign Het
Rasa2 A G 9: 96,544,348 I815T probably benign Het
Rev1 A T 1: 38,088,572 D202E probably benign Het
Sept14 C T 5: 129,693,054 A193T probably damaging Het
Sh3tc1 T C 5: 35,719,026 S112G probably benign Het
Siah3 T A 14: 75,525,554 Y82N probably benign Het
Slc2a7 T C 4: 150,166,396 S425P probably damaging Het
Slc9a2 C T 1: 40,726,388 L313F probably damaging Het
Smdt1 T C 15: 82,346,232 V50A probably benign Het
Supt3 G A 17: 45,036,720 A197T probably benign Het
Tex10 A G 4: 48,436,492 I742T possibly damaging Het
Tex44 T A 1: 86,427,918 H516Q possibly damaging Het
Tfdp1 T G 8: 13,370,917 D171E probably damaging Het
Trim31 A C 17: 36,898,676 D108A probably damaging Het
Ubr1 T C 2: 120,961,098 N135S probably benign Het
Uso1 G A 5: 92,180,563 V340I possibly damaging Het
Utp6 A C 11: 79,948,923 V313G probably damaging Het
Vmn2r107 T C 17: 20,374,847 V554A possibly damaging Het
Xdh C A 17: 73,914,019 E572* probably null Het
Zbtb7c T C 18: 76,136,990 S50P probably damaging Het
Zfp672 A G 11: 58,329,569 probably benign Het
Zzef1 A G 11: 72,900,809 probably null Het
Other mutations in Aste1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02134:Aste1 APN 9 105397844 missense probably damaging 0.99
IGL03161:Aste1 APN 9 105396672 missense probably damaging 1.00
R0022:Aste1 UTSW 9 105396624 nonsense probably null
R0022:Aste1 UTSW 9 105396624 nonsense probably null
R2010:Aste1 UTSW 9 105403502 missense probably damaging 1.00
R5048:Aste1 UTSW 9 105396989 missense probably damaging 1.00
R5084:Aste1 UTSW 9 105397687 nonsense probably null
R5091:Aste1 UTSW 9 105405004 missense probably damaging 1.00
R5197:Aste1 UTSW 9 105405054 missense probably damaging 1.00
R5294:Aste1 UTSW 9 105402705 splice site probably null
R5617:Aste1 UTSW 9 105397835 missense probably benign 0.00
R5834:Aste1 UTSW 9 105403415 missense probably benign 0.01
R6214:Aste1 UTSW 9 105396857 missense probably damaging 0.96
R6215:Aste1 UTSW 9 105396857 missense probably damaging 0.96
R6249:Aste1 UTSW 9 105396617 missense probably benign 0.00
R6913:Aste1 UTSW 9 105397408 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTCCGAAGGACCTTTCTTCACACAC -3'
(R):5'- TGCTGTTATGTCCACATCAAGTGCC -3'

Sequencing Primer
(F):5'- GACCTTTCTTCACACACAGGTAG -3'
(R):5'- ACCTAGTTCACTGGAGGTCTAGC -3'
Posted On2014-03-28