Incidental Mutation 'R1486:Spats2l'
ID163442
Institutional Source Beutler Lab
Gene Symbol Spats2l
Ensembl Gene ENSMUSG00000038305
Gene Namespermatogenesis associated, serine-rich 2-like
SynonymsA230104H11Rik, 2810022L02Rik
MMRRC Submission 039539-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.219) question?
Stock #R1486 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location57774162-57948394 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57900811 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 228 (I228T)
Ref Sequence ENSEMBL: ENSMUSP00000126166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163239] [ENSMUST00000164302] [ENSMUST00000167085] [ENSMUST00000169772] [ENSMUST00000170139] [ENSMUST00000171699] [ENSMUST00000172068]
Predicted Effect possibly damaging
Transcript: ENSMUST00000163239
AA Change: I101T

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000128992
Gene: ENSMUSG00000038305
AA Change: I101T

DomainStartEndE-ValueType
Pfam:DUF1387 1 261 9.7e-124 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164302
SMART Domains Protein: ENSMUSP00000132592
Gene: ENSMUSG00000038305

DomainStartEndE-ValueType
Pfam:DUF1387 59 149 3.6e-25 PFAM
Pfam:DUF1387 146 299 1.6e-93 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164353
Predicted Effect possibly damaging
Transcript: ENSMUST00000167085
AA Change: I228T

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000133054
Gene: ENSMUSG00000038305
AA Change: I228T

DomainStartEndE-ValueType
Pfam:DUF1387 79 388 1.8e-130 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000169772
AA Change: I208T

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000132975
Gene: ENSMUSG00000038305
AA Change: I208T

DomainStartEndE-ValueType
Pfam:DUF1387 59 368 5.6e-139 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000170139
AA Change: I208T

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127598
Gene: ENSMUSG00000038305
AA Change: I208T

DomainStartEndE-ValueType
Pfam:DUF1387 59 368 5.6e-139 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171699
SMART Domains Protein: ENSMUSP00000128239
Gene: ENSMUSG00000038305

DomainStartEndE-ValueType
Pfam:DUF1387 79 169 1.2e-25 PFAM
Pfam:DUF1387 167 270 2e-60 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172068
AA Change: I228T

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126166
Gene: ENSMUSG00000038305
AA Change: I228T

DomainStartEndE-ValueType
Pfam:DUF1387 79 244 5e-43 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A G 2: 130,737,418 L633P probably damaging Het
4930430A15Rik T G 2: 111,200,358 Q402P possibly damaging Het
4933425L06Rik T C 13: 105,109,783 V284A probably benign Het
A730015C16Rik A G 4: 108,847,946 E19G probably benign Het
A730018C14Rik T C 12: 112,415,695 noncoding transcript Het
Acrbp T A 6: 125,050,622 Y78N probably damaging Het
Adamtsl4 T C 3: 95,681,856 S422G probably benign Het
Apba2 T C 7: 64,736,948 V429A probably damaging Het
Atf6 A G 1: 170,794,691 C454R probably damaging Het
Bhlhe40 T C 6: 108,664,929 I278T probably damaging Het
Birc6 G T 17: 74,639,820 V2845L probably damaging Het
Card11 T C 5: 140,876,519 I1008V probably benign Het
Catsperg1 C A 7: 29,185,495 K900N probably damaging Het
Chek2 T G 5: 110,841,227 probably benign Het
Dnah9 A T 11: 65,834,272 S4352T probably damaging Het
Eif3c C T 7: 126,564,721 R50Q probably damaging Het
Eml6 A C 11: 29,805,114 I887S possibly damaging Het
Fopnl A G 16: 14,300,140 V172A probably benign Het
Gipc1 C T 8: 83,661,179 Q63* probably null Het
Grm4 A G 17: 27,434,717 L706P probably damaging Het
Irak3 T C 10: 120,143,061 D495G probably damaging Het
Itga9 T G 9: 118,626,450 V64G probably damaging Het
Iws1 T C 18: 32,097,256 I759T probably damaging Het
Kdm3b T A 18: 34,834,304 F1721I probably damaging Het
Lrrc8c T A 5: 105,607,529 V390E probably damaging Het
Mki67 G A 7: 135,699,720 T1195I probably benign Het
Mphosph8 C T 14: 56,689,039 T646I probably damaging Het
Ncdn A T 4: 126,748,598 V422D probably damaging Het
Nrg1 T C 8: 31,818,344 E548G probably damaging Het
Nup37 T C 10: 88,148,254 Y11H probably damaging Het
Olfr1062 T A 2: 86,423,481 H65L probably damaging Het
Olfr1377 G A 11: 50,984,781 V27I probably benign Het
Olfr585 A T 7: 103,098,430 I230F probably damaging Het
Olfr601 T A 7: 103,358,994 M67L possibly damaging Het
Pcgf1 T G 6: 83,079,126 S70R probably damaging Het
Prps1l3 C T 12: 57,238,787 A121V probably benign Het
Rasal1 T C 5: 120,654,852 Y57H probably damaging Het
Rbm12b2 A G 4: 12,094,841 R567G probably benign Het
Rep15 T A 6: 147,033,079 F139I probably damaging Het
Ros1 T C 10: 52,172,858 Y92C probably damaging Het
Sin3b A G 8: 72,750,513 T803A probably benign Het
Skint11 G A 4: 114,194,818 probably null Het
Sobp T G 10: 43,022,522 S356R probably benign Het
Sqor G A 2: 122,807,645 probably null Het
Stox1 T C 10: 62,664,636 D715G probably benign Het
Tln2 C A 9: 67,311,839 G275W probably damaging Het
Tmc5 C T 7: 118,673,432 P942S probably benign Het
Tor4a A T 2: 25,194,679 I404N possibly damaging Het
Ttc3 G A 16: 94,448,129 R1162Q probably damaging Het
Zfp451 T C 1: 33,777,727 K164E probably damaging Het
Other mutations in Spats2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00771:Spats2l APN 1 57943072 missense probably damaging 1.00
IGL00788:Spats2l APN 1 57885705 missense probably damaging 1.00
IGL01627:Spats2l APN 1 57902082 splice site probably benign
IGL01758:Spats2l APN 1 57879556 missense probably damaging 1.00
IGL03395:Spats2l APN 1 57938016 missense probably damaging 1.00
P0033:Spats2l UTSW 1 57885838 missense probably damaging 0.99
R0762:Spats2l UTSW 1 57885884 missense possibly damaging 0.88
R1167:Spats2l UTSW 1 57943111 missense probably damaging 1.00
R1564:Spats2l UTSW 1 57946224 missense probably damaging 1.00
R1938:Spats2l UTSW 1 57885782 missense probably benign 0.32
R2071:Spats2l UTSW 1 57940464 missense possibly damaging 0.90
R2096:Spats2l UTSW 1 57946299 missense probably benign 0.00
R2215:Spats2l UTSW 1 57946416 missense possibly damaging 0.82
R3053:Spats2l UTSW 1 57900766 missense probably damaging 1.00
R3784:Spats2l UTSW 1 57885779 missense probably damaging 0.99
R4814:Spats2l UTSW 1 57937926 missense possibly damaging 0.83
R4915:Spats2l UTSW 1 57902188 missense probably damaging 1.00
R4962:Spats2l UTSW 1 57885824 missense possibly damaging 0.88
R5022:Spats2l UTSW 1 57879556 missense probably damaging 1.00
R5068:Spats2l UTSW 1 57943221 missense probably benign
R5561:Spats2l UTSW 1 57900621 splice site probably null
R5773:Spats2l UTSW 1 57879549 missense possibly damaging 0.86
R5885:Spats2l UTSW 1 57946162 missense probably damaging 0.96
R6136:Spats2l UTSW 1 57902143 missense probably damaging 1.00
R6651:Spats2l UTSW 1 57946177 missense probably damaging 1.00
R6929:Spats2l UTSW 1 57879536 missense probably damaging 1.00
R7030:Spats2l UTSW 1 57879530 missense probably damaging 1.00
X0054:Spats2l UTSW 1 57943243 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCTCTTACAGAAGGCGGCAGACTAC -3'
(R):5'- ACACATTCATCCACAGAGGGGCAG -3'

Sequencing Primer
(F):5'- AGCGATTCATGGACCATCAG -3'
(R):5'- GCCACCCTGGCATTTTTATG -3'
Posted On2014-03-28