Incidental Mutation 'R1486:Skint11'
ID163453
Institutional Source Beutler Lab
Gene Symbol Skint11
Ensembl Gene ENSMUSG00000057977
Gene Nameselection and upkeep of intraepithelial T cells 11
SynonymsA630098G03Rik
MMRRC Submission 039539-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R1486 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location114163384-114245028 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 114194818 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079915] [ENSMUST00000145797] [ENSMUST00000151810] [ENSMUST00000164297]
Predicted Effect probably benign
Transcript: ENSMUST00000079915
SMART Domains Protein: ENSMUSP00000078836
Gene: ENSMUSG00000057977

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000145797
SMART Domains Protein: ENSMUSP00000118895
Gene: ENSMUSG00000057977

DomainStartEndE-ValueType
Pfam:C2-set_2 29 113 6.4e-7 PFAM
transmembrane domain 138 160 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000151810
SMART Domains Protein: ENSMUSP00000119157
Gene: ENSMUSG00000057977

DomainStartEndE-ValueType
Pfam:C2-set_2 3 87 6e-7 PFAM
transmembrane domain 112 134 N/A INTRINSIC
transmembrane domain 161 183 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000164297
SMART Domains Protein: ENSMUSP00000127138
Gene: ENSMUSG00000057977

DomainStartEndE-ValueType
PDB:4F8T|A 19 125 6e-9 PDB
Blast:IG_like 40 119 1e-10 BLAST
transmembrane domain 138 160 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
transmembrane domain 224 246 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A G 2: 130,737,418 L633P probably damaging Het
4930430A15Rik T G 2: 111,200,358 Q402P possibly damaging Het
4933425L06Rik T C 13: 105,109,783 V284A probably benign Het
A730015C16Rik A G 4: 108,847,946 E19G probably benign Het
A730018C14Rik T C 12: 112,415,695 noncoding transcript Het
Acrbp T A 6: 125,050,622 Y78N probably damaging Het
Adamtsl4 T C 3: 95,681,856 S422G probably benign Het
Apba2 T C 7: 64,736,948 V429A probably damaging Het
Atf6 A G 1: 170,794,691 C454R probably damaging Het
Bhlhe40 T C 6: 108,664,929 I278T probably damaging Het
Birc6 G T 17: 74,639,820 V2845L probably damaging Het
Card11 T C 5: 140,876,519 I1008V probably benign Het
Catsperg1 C A 7: 29,185,495 K900N probably damaging Het
Chek2 T G 5: 110,841,227 probably benign Het
Dnah9 A T 11: 65,834,272 S4352T probably damaging Het
Eif3c C T 7: 126,564,721 R50Q probably damaging Het
Eml6 A C 11: 29,805,114 I887S possibly damaging Het
Fopnl A G 16: 14,300,140 V172A probably benign Het
Gipc1 C T 8: 83,661,179 Q63* probably null Het
Grm4 A G 17: 27,434,717 L706P probably damaging Het
Irak3 T C 10: 120,143,061 D495G probably damaging Het
Itga9 T G 9: 118,626,450 V64G probably damaging Het
Iws1 T C 18: 32,097,256 I759T probably damaging Het
Kdm3b T A 18: 34,834,304 F1721I probably damaging Het
Lrrc8c T A 5: 105,607,529 V390E probably damaging Het
Mki67 G A 7: 135,699,720 T1195I probably benign Het
Mphosph8 C T 14: 56,689,039 T646I probably damaging Het
Ncdn A T 4: 126,748,598 V422D probably damaging Het
Nrg1 T C 8: 31,818,344 E548G probably damaging Het
Nup37 T C 10: 88,148,254 Y11H probably damaging Het
Olfr1062 T A 2: 86,423,481 H65L probably damaging Het
Olfr1377 G A 11: 50,984,781 V27I probably benign Het
Olfr585 A T 7: 103,098,430 I230F probably damaging Het
Olfr601 T A 7: 103,358,994 M67L possibly damaging Het
Pcgf1 T G 6: 83,079,126 S70R probably damaging Het
Prps1l3 C T 12: 57,238,787 A121V probably benign Het
Rasal1 T C 5: 120,654,852 Y57H probably damaging Het
Rbm12b2 A G 4: 12,094,841 R567G probably benign Het
Rep15 T A 6: 147,033,079 F139I probably damaging Het
Ros1 T C 10: 52,172,858 Y92C probably damaging Het
Sin3b A G 8: 72,750,513 T803A probably benign Het
Sobp T G 10: 43,022,522 S356R probably benign Het
Spats2l T C 1: 57,900,811 I228T probably damaging Het
Sqor G A 2: 122,807,645 probably null Het
Stox1 T C 10: 62,664,636 D715G probably benign Het
Tln2 C A 9: 67,311,839 G275W probably damaging Het
Tmc5 C T 7: 118,673,432 P942S probably benign Het
Tor4a A T 2: 25,194,679 I404N possibly damaging Het
Ttc3 G A 16: 94,448,129 R1162Q probably damaging Het
Zfp451 T C 1: 33,777,727 K164E probably damaging Het
Other mutations in Skint11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Skint11 APN 4 114194709 missense probably benign 0.03
IGL00775:Skint11 APN 4 114194692 missense probably damaging 1.00
IGL02186:Skint11 APN 4 114244636 missense possibly damaging 0.82
IGL02499:Skint11 APN 4 114194604 missense probably benign 0.01
IGL02622:Skint11 APN 4 114194728 missense probably damaging 1.00
IGL03115:Skint11 APN 4 114244623 missense probably damaging 0.99
R0513:Skint11 UTSW 4 114194565 missense probably benign 0.00
R0928:Skint11 UTSW 4 114244601 missense possibly damaging 0.95
R1508:Skint11 UTSW 4 114231766 critical splice donor site probably null
R1667:Skint11 UTSW 4 114194781 missense probably damaging 0.99
R1807:Skint11 UTSW 4 114194696 missense probably benign 0.08
R2504:Skint11 UTSW 4 114228812 missense possibly damaging 0.55
R4165:Skint11 UTSW 4 114244659 missense probably benign 0.00
R4166:Skint11 UTSW 4 114244659 missense probably benign 0.00
R4231:Skint11 UTSW 4 114244659 missense probably benign 0.00
R4233:Skint11 UTSW 4 114244659 missense probably benign 0.00
R4234:Skint11 UTSW 4 114244659 missense probably benign 0.00
R4236:Skint11 UTSW 4 114244659 missense probably benign 0.00
R4756:Skint11 UTSW 4 114194677 missense probably benign 0.30
R4947:Skint11 UTSW 4 114191510 missense possibly damaging 0.89
R5237:Skint11 UTSW 4 114244845 missense possibly damaging 0.66
R5538:Skint11 UTSW 4 114231762 missense probably damaging 0.99
R5555:Skint11 UTSW 4 114194601 missense probably benign 0.03
R6004:Skint11 UTSW 4 114231728 missense probably benign 0.37
R6209:Skint11 UTSW 4 114244710 missense possibly damaging 0.73
R7121:Skint11 UTSW 4 114227796 missense not run
Predicted Primers PCR Primer
(F):5'- CCACCCTCAAGCACATTTGACTCTC -3'
(R):5'- CCTTGACTCCTCTTATCCACAAAGACAC -3'

Sequencing Primer
(F):5'- CACATTTGACTCTCAGGATAGAGC -3'
(R):5'- aaagaccagaaaggggcac -3'
Posted On2014-03-28