Incidental Mutation 'R1486:Rep15'
ID163464
Institutional Source Beutler Lab
Gene Symbol Rep15
Ensembl Gene ENSMUSG00000040121
Gene NameRAB15 effector protein
Synonyms
MMRRC Submission 039539-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R1486 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location147032584-147034245 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 147033079 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 139 (F139I)
Ref Sequence ENSEMBL: ENSMUSP00000037503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016631] [ENSMUST00000036194] [ENSMUST00000111623]
Predicted Effect probably benign
Transcript: ENSMUST00000016631
SMART Domains Protein: ENSMUSP00000016631
Gene: ENSMUSG00000016487

DomainStartEndE-ValueType
low complexity region 1 13 N/A INTRINSIC
PDB:3QH9|A 180 256 3e-8 PDB
low complexity region 345 358 N/A INTRINSIC
low complexity region 426 441 N/A INTRINSIC
low complexity region 530 546 N/A INTRINSIC
SAM 603 670 3.06e-13 SMART
SAM 675 741 2.39e-15 SMART
SAM 763 835 7.91e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000036194
AA Change: F139I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000037503
Gene: ENSMUSG00000040121
AA Change: F139I

DomainStartEndE-ValueType
Pfam:Rab15_effector 1 230 3.2e-119 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111623
SMART Domains Protein: ENSMUSP00000107250
Gene: ENSMUSG00000016487

DomainStartEndE-ValueType
low complexity region 1 13 N/A INTRINSIC
PDB:3QH9|A 180 256 3e-8 PDB
low complexity region 272 284 N/A INTRINSIC
low complexity region 356 369 N/A INTRINSIC
low complexity region 437 452 N/A INTRINSIC
low complexity region 541 557 N/A INTRINSIC
SAM 614 681 3.06e-13 SMART
SAM 686 752 2.39e-15 SMART
SAM 774 846 7.91e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123902
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205044
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this intronless gene interacts with GTP-bound Rab15 and is involved in recycling of transferrin receptor from the endocytic recycling compartment to the cell surface. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A G 2: 130,737,418 L633P probably damaging Het
4930430A15Rik T G 2: 111,200,358 Q402P possibly damaging Het
4933425L06Rik T C 13: 105,109,783 V284A probably benign Het
A730015C16Rik A G 4: 108,847,946 E19G probably benign Het
A730018C14Rik T C 12: 112,415,695 noncoding transcript Het
Acrbp T A 6: 125,050,622 Y78N probably damaging Het
Adamtsl4 T C 3: 95,681,856 S422G probably benign Het
Apba2 T C 7: 64,736,948 V429A probably damaging Het
Atf6 A G 1: 170,794,691 C454R probably damaging Het
Bhlhe40 T C 6: 108,664,929 I278T probably damaging Het
Birc6 G T 17: 74,639,820 V2845L probably damaging Het
Card11 T C 5: 140,876,519 I1008V probably benign Het
Catsperg1 C A 7: 29,185,495 K900N probably damaging Het
Chek2 T G 5: 110,841,227 probably benign Het
Dnah9 A T 11: 65,834,272 S4352T probably damaging Het
Eif3c C T 7: 126,564,721 R50Q probably damaging Het
Eml6 A C 11: 29,805,114 I887S possibly damaging Het
Fopnl A G 16: 14,300,140 V172A probably benign Het
Gipc1 C T 8: 83,661,179 Q63* probably null Het
Grm4 A G 17: 27,434,717 L706P probably damaging Het
Irak3 T C 10: 120,143,061 D495G probably damaging Het
Itga9 T G 9: 118,626,450 V64G probably damaging Het
Iws1 T C 18: 32,097,256 I759T probably damaging Het
Kdm3b T A 18: 34,834,304 F1721I probably damaging Het
Lrrc8c T A 5: 105,607,529 V390E probably damaging Het
Mki67 G A 7: 135,699,720 T1195I probably benign Het
Mphosph8 C T 14: 56,689,039 T646I probably damaging Het
Ncdn A T 4: 126,748,598 V422D probably damaging Het
Nrg1 T C 8: 31,818,344 E548G probably damaging Het
Nup37 T C 10: 88,148,254 Y11H probably damaging Het
Olfr1062 T A 2: 86,423,481 H65L probably damaging Het
Olfr1377 G A 11: 50,984,781 V27I probably benign Het
Olfr585 A T 7: 103,098,430 I230F probably damaging Het
Olfr601 T A 7: 103,358,994 M67L possibly damaging Het
Pcgf1 T G 6: 83,079,126 S70R probably damaging Het
Prps1l3 C T 12: 57,238,787 A121V probably benign Het
Rasal1 T C 5: 120,654,852 Y57H probably damaging Het
Rbm12b2 A G 4: 12,094,841 R567G probably benign Het
Ros1 T C 10: 52,172,858 Y92C probably damaging Het
Sin3b A G 8: 72,750,513 T803A probably benign Het
Skint11 G A 4: 114,194,818 probably null Het
Sobp T G 10: 43,022,522 S356R probably benign Het
Spats2l T C 1: 57,900,811 I228T probably damaging Het
Sqor G A 2: 122,807,645 probably null Het
Stox1 T C 10: 62,664,636 D715G probably benign Het
Tln2 C A 9: 67,311,839 G275W probably damaging Het
Tmc5 C T 7: 118,673,432 P942S probably benign Het
Tor4a A T 2: 25,194,679 I404N possibly damaging Het
Ttc3 G A 16: 94,448,129 R1162Q probably damaging Het
Zfp451 T C 1: 33,777,727 K164E probably damaging Het
Other mutations in Rep15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02137:Rep15 APN 6 147033347 missense probably benign 0.00
IGL03324:Rep15 APN 6 147032665 start codon destroyed possibly damaging 0.87
R1282:Rep15 UTSW 6 147033229 nonsense probably null
R2102:Rep15 UTSW 6 147032905 unclassified probably null
R5613:Rep15 UTSW 6 147032854 missense possibly damaging 0.65
X0028:Rep15 UTSW 6 147032732 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTCGTTACCTTCTGCCAGGAAAG -3'
(R):5'- TAAACTCTGCCCATGTCACTCAGCC -3'

Sequencing Primer
(F):5'- GATGAGTGGCTCACCACC -3'
(R):5'- CCTAGCAGCTCTTTGATGGAGATAC -3'
Posted On2014-03-28