Incidental Mutation 'R1487:Tns2'
ID163559
Institutional Source Beutler Lab
Gene Symbol Tns2
Ensembl Gene ENSMUSG00000037003
Gene Nametensin 2
Synonymsnph, nep, Tenc1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1487 (G1)
Quality Score179
Status Not validated
Chromosome15
Chromosomal Location102100413-102116401 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 102108934 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 281 (R281C)
Ref Sequence ENSEMBL: ENSMUSP00000155830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046144] [ENSMUST00000169627] [ENSMUST00000228958] [ENSMUST00000229592] [ENSMUST00000230474]
Predicted Effect probably damaging
Transcript: ENSMUST00000046144
AA Change: R281C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041087
Gene: ENSMUSG00000037003
AA Change: R281C

DomainStartEndE-ValueType
C1 32 79 2.78e-9 SMART
SCOP:d1d5ra2 128 295 8e-24 SMART
PTEN_C2 297 424 6.63e-40 SMART
low complexity region 494 513 N/A INTRINSIC
SH2 1136 1236 1.69e-16 SMART
PTB 1269 1407 6.66e-28 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169627
AA Change: R281C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129146
Gene: ENSMUSG00000037003
AA Change: R281C

DomainStartEndE-ValueType
C1 32 79 2.78e-9 SMART
SCOP:d1d5ra2 128 295 8e-24 SMART
PTEN_C2 297 424 6.63e-40 SMART
low complexity region 494 513 N/A INTRINSIC
SH2 1129 1229 1.69e-16 SMART
PTB 1262 1400 6.66e-28 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000228958
AA Change: R281C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229035
Predicted Effect probably benign
Transcript: ENSMUST00000229592
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229908
Predicted Effect probably damaging
Transcript: ENSMUST00000230474
AA Change: R273C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.344 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype Strain: 2447990
Lethality: D70-D210
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the tensin family. Tensin is a focal adhesion molecule that binds to actin filaments and participates in signaling pathways. This protein plays a role in regulating cell migration. Alternative splicing occurs at this locus and three transcript variants encoding three distinct isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Affected mice homozygous for a spontaneous deletion show reduced female fertility, increased blood urea nitrogen, low hematocrit, proteinuria, hypoproteinemia, hypercholesterolemia, small kidneys with a yellowish granular surface, glomerular lesions and premature death; some develop systemic edema. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik A C 6: 146,953,379 V55G probably benign Het
2410089E03Rik C T 15: 8,186,231 R424W probably damaging Het
9130011E15Rik A C 19: 45,940,443 probably null Het
Abhd13 A G 8: 9,987,402 probably benign Het
Arid5b T A 10: 68,097,214 K953* probably null Het
Armc4 A T 18: 7,273,245 Y282N probably damaging Het
B4galt6 A G 18: 20,706,514 V121A possibly damaging Het
C1qtnf12 G A 4: 155,965,874 E223K probably damaging Het
Calu A G 6: 29,366,956 I208V probably benign Het
Cd14 T C 18: 36,725,484 N306S probably benign Het
Cdc16 T A 8: 13,771,445 N415K probably benign Het
Cfap57 C A 4: 118,614,781 V134F probably benign Het
Chrna2 C T 14: 66,143,363 A27V probably benign Het
Chtf18 T C 17: 25,720,609 K67R probably benign Het
Clock T C 5: 76,266,354 probably null Het
Eif4g1 G A 16: 20,678,873 probably benign Het
Eps8l2 A T 7: 141,361,618 M601L probably benign Het
Fat4 A G 3: 38,995,917 E3976G possibly damaging Het
Flrt3 T A 2: 140,660,934 H258L probably damaging Het
Flt4 C A 11: 49,633,144 T517K possibly damaging Het
Galnt7 T C 8: 57,540,039 N416S probably damaging Het
Gipc1 C T 8: 83,661,179 Q63* probably null Het
Gm17079 A T 14: 51,693,085 probably null Het
Gucy2c T A 6: 136,748,826 I375F possibly damaging Het
Hps4 C T 5: 112,377,999 Q629* probably null Het
Hunk A G 16: 90,386,637 Y61C probably damaging Het
Itga6 T C 2: 71,843,240 S873P possibly damaging Het
Kcnc1 A G 7: 46,397,874 H66R possibly damaging Het
Kcnc1 T C 7: 46,435,348 probably null Het
Khdc3 A G 9: 73,102,564 T19A probably benign Het
Kmt2a T C 9: 44,833,990 probably benign Het
Lipe C T 7: 25,384,815 A615T possibly damaging Het
Lrguk A T 6: 34,062,360 M269L probably benign Het
Lrrc18 A G 14: 33,008,683 N60D probably damaging Het
Magi1 T C 6: 93,708,079 T773A probably benign Het
Map3k14 T A 11: 103,225,337 D755V possibly damaging Het
Mecom T C 3: 29,980,064 T488A probably damaging Het
Mmp10 T G 9: 7,509,977 W473G probably damaging Het
Mrgpra2a C T 7: 47,426,686 V275I probably benign Het
Myo7a A C 7: 98,053,810 probably null Het
Nadsyn1 C T 7: 143,806,925 V369I probably benign Het
Nptxr C A 15: 79,789,903 G424V probably damaging Het
Nrg2 C T 18: 36,052,912 G258E possibly damaging Het
Nup210 G A 6: 91,042,576 P221S probably damaging Het
Olfr622 T A 7: 103,639,594 H182L probably damaging Het
Olfr784 T C 10: 129,388,340 F236L probably benign Het
Oxct1 A G 15: 4,147,575 D477G possibly damaging Het
Pcdh8 G T 14: 79,769,547 D525E probably damaging Het
Phldb2 A G 16: 45,789,024 S740P probably damaging Het
Prss54 A G 8: 95,559,648 S266P probably benign Het
Ptprh T A 7: 4,552,738 I741F probably damaging Het
Rab11fip1 G T 8: 27,154,212 S515Y probably damaging Het
Recql4 T A 15: 76,708,983 N309I probably benign Het
Sec24a T C 11: 51,731,886 T388A possibly damaging Het
Setd6 T A 8: 95,717,928 L83H probably damaging Het
Slc6a12 G A 6: 121,363,757 W534* probably null Het
St14 C T 9: 31,097,180 C488Y probably damaging Het
Supt16 A G 14: 52,176,608 probably null Het
Tanc2 A G 11: 105,923,634 Y1968C probably damaging Het
Tcaim T A 9: 122,818,832 Y137* probably null Het
Tpm3 A T 3: 90,090,082 probably null Het
Trip12 A T 1: 84,768,631 N475K probably damaging Het
Twnk G T 19: 45,008,376 probably null Het
Zfp287 T C 11: 62,725,289 K192R probably damaging Het
Zfp799 G T 17: 32,820,677 T204N possibly damaging Het
Other mutations in Tns2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01575:Tns2 APN 15 102113191 missense probably damaging 1.00
IGL01935:Tns2 APN 15 102111634 unclassified probably null
IGL01994:Tns2 APN 15 102111379 missense possibly damaging 0.81
IGL02025:Tns2 APN 15 102112049 nonsense probably null
IGL02135:Tns2 APN 15 102113026 missense probably damaging 1.00
IGL02355:Tns2 APN 15 102112290 missense probably benign
IGL02362:Tns2 APN 15 102112290 missense probably benign
IGL02439:Tns2 APN 15 102114543 missense probably damaging 1.00
IGL02488:Tns2 APN 15 102112743 missense probably benign
IGL02546:Tns2 APN 15 102110940 missense probably damaging 1.00
IGL02616:Tns2 APN 15 102111415 missense probably benign
IGL02628:Tns2 APN 15 102111828 missense probably benign 0.04
IGL02658:Tns2 APN 15 102107796 splice site probably benign
IGL03267:Tns2 APN 15 102105378 critical splice donor site probably null
P0005:Tns2 UTSW 15 102114056 missense probably damaging 0.98
R0586:Tns2 UTSW 15 102109585 splice site probably benign
R0791:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R0817:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R0818:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R0819:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R0820:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1451:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1452:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1453:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1454:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1455:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1510:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1579:Tns2 UTSW 15 102111210 missense probably damaging 1.00
R1698:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1772:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1779:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1843:Tns2 UTSW 15 102113133 unclassified probably null
R1923:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1924:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1927:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1980:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2051:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2087:Tns2 UTSW 15 102107119 missense possibly damaging 0.70
R2100:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2103:Tns2 UTSW 15 102112665 critical splice acceptor site probably null
R2105:Tns2 UTSW 15 102107506 missense probably benign 0.27
R2224:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2225:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2227:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2252:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2253:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2290:Tns2 UTSW 15 102112023 missense probably damaging 0.99
R2304:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2318:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2446:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2447:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2448:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2566:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2567:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2897:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2898:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R3159:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R3160:Tns2 UTSW 15 102113336 missense possibly damaging 0.88
R3162:Tns2 UTSW 15 102113336 missense possibly damaging 0.88
R3162:Tns2 UTSW 15 102113336 missense possibly damaging 0.88
R3196:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R3237:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R3426:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R3427:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R3428:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R3695:Tns2 UTSW 15 102112749 missense probably null
R3767:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R3911:Tns2 UTSW 15 102113837 critical splice donor site probably null
R4113:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4157:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4394:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4395:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4396:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4439:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4441:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4537:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4538:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4541:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4599:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4600:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4602:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4773:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4774:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4775:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4776:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4880:Tns2 UTSW 15 102112039 missense probably damaging 0.98
R4989:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R5014:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R5058:Tns2 UTSW 15 102107860 missense possibly damaging 0.68
R5253:Tns2 UTSW 15 102111453 missense probably damaging 1.00
R5336:Tns2 UTSW 15 102111229 missense probably damaging 1.00
R5351:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R5452:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R5453:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R5629:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R5630:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R5631:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R5685:Tns2 UTSW 15 102107103 missense probably benign 0.02
R5844:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R6048:Tns2 UTSW 15 102111411 missense probably damaging 1.00
R6067:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R6079:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R6130:Tns2 UTSW 15 102111241 missense probably damaging 1.00
R6136:Tns2 UTSW 15 102107030 missense probably damaging 1.00
R6138:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R6199:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R6210:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R6426:Tns2 UTSW 15 102107037 missense possibly damaging 0.65
R6544:Tns2 UTSW 15 102113834 missense possibly damaging 0.93
R6594:Tns2 UTSW 15 102110559 missense probably benign 0.00
R6596:Tns2 UTSW 15 102110559 missense probably benign 0.00
R6734:Tns2 UTSW 15 102103116 missense probably damaging 0.96
U15987:Tns2 UTSW 15 102108934 missense probably damaging 1.00
X0009:Tns2 UTSW 15 102112465 missense possibly damaging 0.94
X0026:Tns2 UTSW 15 102110502 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTTGACAAGCGAGGAAAGCCAG -3'
(R):5'- GTGCCAAGAAAGCATCAGCGTC -3'

Sequencing Primer
(F):5'- CCGGGAAACTGACTATGCTG -3'
(R):5'- cagaccttatcgccagcc -3'
Posted On2014-03-28