Incidental Mutation 'R1487:Twnk'
ID163570
Institutional Source Beutler Lab
Gene Symbol Twnk
Ensembl Gene ENSMUSG00000025209
Gene Nametwinkle mtDNA helicase
Synonymstwinkle, Twinl, Peo1, D19Ertd626e
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1487 (G1)
Quality Score143
Status Not validated
Chromosome19
Chromosomal Location45006558-45012762 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to T at 45008376 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000026227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026225] [ENSMUST00000026227] [ENSMUST00000097715] [ENSMUST00000130549] [ENSMUST00000179305]
Predicted Effect probably benign
Transcript: ENSMUST00000026225
SMART Domains Protein: ENSMUSP00000026225
Gene: ENSMUSG00000025207

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Sema 56 487 2.38e-165 SMART
PSI 505 556 6.59e-13 SMART
IG 567 649 6.26e-5 SMART
low complexity region 650 666 N/A INTRINSIC
transmembrane domain 677 699 N/A INTRINSIC
low complexity region 701 708 N/A INTRINSIC
low complexity region 713 720 N/A INTRINSIC
low complexity region 734 751 N/A INTRINSIC
low complexity region 761 774 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000026227
SMART Domains Protein: ENSMUSP00000026227
Gene: ENSMUSG00000025209

DomainStartEndE-ValueType
low complexity region 213 224 N/A INTRINSIC
Blast:TOPRIM 260 331 8e-16 BLAST
Pfam:AAA_25 377 565 5.6e-25 PFAM
Pfam:DnaB_C 390 631 6.7e-17 PFAM
Pfam:KaiC 394 628 2.6e-11 PFAM
low complexity region 650 661 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097715
SMART Domains Protein: ENSMUSP00000095322
Gene: ENSMUSG00000025208

DomainStartEndE-ValueType
L51_S25_CI-B8 35 108 1.61e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130549
SMART Domains Protein: ENSMUSP00000138321
Gene: ENSMUSG00000025207

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Sema 56 487 2.38e-165 SMART
PSI 505 556 6.59e-13 SMART
IG 567 649 6.26e-5 SMART
low complexity region 650 666 N/A INTRINSIC
transmembrane domain 677 699 N/A INTRINSIC
low complexity region 701 708 N/A INTRINSIC
low complexity region 713 720 N/A INTRINSIC
low complexity region 734 751 N/A INTRINSIC
low complexity region 761 774 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179305
SMART Domains Protein: ENSMUSP00000137395
Gene: ENSMUSG00000025207

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Sema 56 487 2.38e-165 SMART
PSI 505 556 6.59e-13 SMART
IG 567 649 6.26e-5 SMART
low complexity region 650 666 N/A INTRINSIC
transmembrane domain 677 699 N/A INTRINSIC
low complexity region 701 708 N/A INTRINSIC
low complexity region 713 720 N/A INTRINSIC
low complexity region 734 751 N/A INTRINSIC
low complexity region 761 774 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a hexameric DNA helicase which unwinds short stretches of double-stranded DNA in the 5' to 3' direction and, along with mitochondrial single-stranded DNA binding protein and mtDNA polymerase gamma, is thought to play a key role in mtDNA replication. The protein localizes to the mitochondrial matrix and mitochondrial nucleoids. Mutations in this gene cause infantile onset spinocerebellar ataxia (IOSCA) and progressive external ophthalmoplegia (PEO) and are also associated with several mitochondrial depletion syndromes. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Aug 2009]
PHENOTYPE: Homozygous embryos display abnormal development. Embryos die around E8.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik A C 6: 146,953,379 V55G probably benign Het
2410089E03Rik C T 15: 8,186,231 R424W probably damaging Het
9130011E15Rik A C 19: 45,940,443 probably null Het
Abhd13 A G 8: 9,987,402 probably benign Het
Arid5b T A 10: 68,097,214 K953* probably null Het
Armc4 A T 18: 7,273,245 Y282N probably damaging Het
B4galt6 A G 18: 20,706,514 V121A possibly damaging Het
C1qtnf12 G A 4: 155,965,874 E223K probably damaging Het
Calu A G 6: 29,366,956 I208V probably benign Het
Cd14 T C 18: 36,725,484 N306S probably benign Het
Cdc16 T A 8: 13,771,445 N415K probably benign Het
Cfap57 C A 4: 118,614,781 V134F probably benign Het
Chrna2 C T 14: 66,143,363 A27V probably benign Het
Chtf18 T C 17: 25,720,609 K67R probably benign Het
Clock T C 5: 76,266,354 probably null Het
Eif4g1 G A 16: 20,678,873 probably benign Het
Eps8l2 A T 7: 141,361,618 M601L probably benign Het
Fat4 A G 3: 38,995,917 E3976G possibly damaging Het
Flrt3 T A 2: 140,660,934 H258L probably damaging Het
Flt4 C A 11: 49,633,144 T517K possibly damaging Het
Galnt7 T C 8: 57,540,039 N416S probably damaging Het
Gipc1 C T 8: 83,661,179 Q63* probably null Het
Gm17079 A T 14: 51,693,085 probably null Het
Gucy2c T A 6: 136,748,826 I375F possibly damaging Het
Hps4 C T 5: 112,377,999 Q629* probably null Het
Hunk A G 16: 90,386,637 Y61C probably damaging Het
Itga6 T C 2: 71,843,240 S873P possibly damaging Het
Kcnc1 A G 7: 46,397,874 H66R possibly damaging Het
Kcnc1 T C 7: 46,435,348 probably null Het
Khdc3 A G 9: 73,102,564 T19A probably benign Het
Kmt2a T C 9: 44,833,990 probably benign Het
Lipe C T 7: 25,384,815 A615T possibly damaging Het
Lrguk A T 6: 34,062,360 M269L probably benign Het
Lrrc18 A G 14: 33,008,683 N60D probably damaging Het
Magi1 T C 6: 93,708,079 T773A probably benign Het
Map3k14 T A 11: 103,225,337 D755V possibly damaging Het
Mecom T C 3: 29,980,064 T488A probably damaging Het
Mmp10 T G 9: 7,509,977 W473G probably damaging Het
Mrgpra2a C T 7: 47,426,686 V275I probably benign Het
Myo7a A C 7: 98,053,810 probably null Het
Nadsyn1 C T 7: 143,806,925 V369I probably benign Het
Nptxr C A 15: 79,789,903 G424V probably damaging Het
Nrg2 C T 18: 36,052,912 G258E possibly damaging Het
Nup210 G A 6: 91,042,576 P221S probably damaging Het
Olfr622 T A 7: 103,639,594 H182L probably damaging Het
Olfr784 T C 10: 129,388,340 F236L probably benign Het
Oxct1 A G 15: 4,147,575 D477G possibly damaging Het
Pcdh8 G T 14: 79,769,547 D525E probably damaging Het
Phldb2 A G 16: 45,789,024 S740P probably damaging Het
Prss54 A G 8: 95,559,648 S266P probably benign Het
Ptprh T A 7: 4,552,738 I741F probably damaging Het
Rab11fip1 G T 8: 27,154,212 S515Y probably damaging Het
Recql4 T A 15: 76,708,983 N309I probably benign Het
Sec24a T C 11: 51,731,886 T388A possibly damaging Het
Setd6 T A 8: 95,717,928 L83H probably damaging Het
Slc6a12 G A 6: 121,363,757 W534* probably null Het
St14 C T 9: 31,097,180 C488Y probably damaging Het
Supt16 A G 14: 52,176,608 probably null Het
Tanc2 A G 11: 105,923,634 Y1968C probably damaging Het
Tcaim T A 9: 122,818,832 Y137* probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tpm3 A T 3: 90,090,082 probably null Het
Trip12 A T 1: 84,768,631 N475K probably damaging Het
Zfp287 T C 11: 62,725,289 K192R probably damaging Het
Zfp799 G T 17: 32,820,677 T204N possibly damaging Het
Other mutations in Twnk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00858:Twnk APN 19 45007626 missense probably benign 0.03
IGL01367:Twnk APN 19 45011651 missense possibly damaging 0.92
IGL01736:Twnk APN 19 45010188 missense probably damaging 0.97
IGL02724:Twnk APN 19 45008118 missense probably damaging 0.99
IGL03368:Twnk APN 19 45010492 missense probably damaging 0.99
R0121:Twnk UTSW 19 45009265 unclassified probably benign
R0389:Twnk UTSW 19 45008139 missense possibly damaging 0.67
R0427:Twnk UTSW 19 45007587 missense probably benign 0.00
R0443:Twnk UTSW 19 45008139 missense possibly damaging 0.67
R0501:Twnk UTSW 19 45007746 missense probably damaging 1.00
R0791:Twnk UTSW 19 45010254 unclassified probably benign
R1193:Twnk UTSW 19 45007790 missense probably damaging 1.00
R1470:Twnk UTSW 19 45009381 missense probably damaging 1.00
R1470:Twnk UTSW 19 45009381 missense probably damaging 1.00
R1556:Twnk UTSW 19 45009411 missense possibly damaging 0.80
R3895:Twnk UTSW 19 45007451 missense probably damaging 0.98
R5652:Twnk UTSW 19 45007293 missense possibly damaging 0.85
R6373:Twnk UTSW 19 45009381 missense probably damaging 1.00
R6595:Twnk UTSW 19 45010492 missense probably damaging 0.99
R6880:Twnk UTSW 19 45007416 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTGTTTGCTCGAAAACTCAACCCC -3'
(R):5'- AGCATTCATGCACATAGACACTGCC -3'

Sequencing Primer
(F):5'- CAAGCGATGCTCTCTGGTG -3'
(R):5'- tggattacaggtacgcttgg -3'
Posted On2014-03-28