Incidental Mutation 'R1489:Map1a'
ID163584
Institutional Source Beutler Lab
Gene Symbol Map1a
Ensembl Gene ENSMUSG00000027254
Gene Namemicrotubule-associated protein 1 A
SynonymsMtap1, Mtap-1, 6330416M19Rik, Mtap1a
MMRRC Submission 039541-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.258) question?
Stock #R1489 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location121289600-121310832 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121300437 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 578 (V578A)
Ref Sequence ENSEMBL: ENSMUSP00000092223 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094639] [ENSMUST00000110639]
Predicted Effect possibly damaging
Transcript: ENSMUST00000094639
AA Change: V578A

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000092223
Gene: ENSMUSG00000027254
AA Change: V578A

DomainStartEndE-ValueType
Blast:Lactamase_B 286 538 2e-54 BLAST
SCOP:d1eq1a_ 584 699 8e-5 SMART
low complexity region 743 755 N/A INTRINSIC
low complexity region 820 833 N/A INTRINSIC
low complexity region 852 867 N/A INTRINSIC
low complexity region 897 911 N/A INTRINSIC
low complexity region 1228 1239 N/A INTRINSIC
low complexity region 1334 1344 N/A INTRINSIC
low complexity region 1540 1555 N/A INTRINSIC
coiled coil region 1573 1602 N/A INTRINSIC
internal_repeat_1 1616 1726 7.66e-6 PROSPERO
coiled coil region 1747 1771 N/A INTRINSIC
internal_repeat_1 1774 1888 7.66e-6 PROSPERO
low complexity region 2060 2084 N/A INTRINSIC
low complexity region 2121 2133 N/A INTRINSIC
low complexity region 2156 2169 N/A INTRINSIC
low complexity region 2383 2396 N/A INTRINSIC
low complexity region 2436 2460 N/A INTRINSIC
low complexity region 2517 2541 N/A INTRINSIC
low complexity region 2589 2600 N/A INTRINSIC
low complexity region 2662 2682 N/A INTRINSIC
low complexity region 2685 2704 N/A INTRINSIC
low complexity region 2716 2728 N/A INTRINSIC
low complexity region 2766 2790 N/A INTRINSIC
low complexity region 2980 2988 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110639
AA Change: V340A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000106269
Gene: ENSMUSG00000027254
AA Change: V340A

DomainStartEndE-ValueType
Blast:Lactamase_B 48 300 3e-54 BLAST
SCOP:d1eq1a_ 346 461 1e-4 SMART
low complexity region 505 517 N/A INTRINSIC
low complexity region 582 595 N/A INTRINSIC
low complexity region 614 629 N/A INTRINSIC
low complexity region 659 673 N/A INTRINSIC
low complexity region 990 1001 N/A INTRINSIC
low complexity region 1096 1106 N/A INTRINSIC
low complexity region 1302 1317 N/A INTRINSIC
coiled coil region 1335 1364 N/A INTRINSIC
internal_repeat_1 1378 1488 5.43e-6 PROSPERO
coiled coil region 1509 1533 N/A INTRINSIC
internal_repeat_1 1536 1650 5.43e-6 PROSPERO
low complexity region 1822 1846 N/A INTRINSIC
low complexity region 1883 1895 N/A INTRINSIC
low complexity region 1918 1931 N/A INTRINSIC
low complexity region 2145 2158 N/A INTRINSIC
low complexity region 2198 2222 N/A INTRINSIC
low complexity region 2279 2303 N/A INTRINSIC
low complexity region 2351 2362 N/A INTRINSIC
low complexity region 2424 2444 N/A INTRINSIC
low complexity region 2447 2466 N/A INTRINSIC
low complexity region 2478 2490 N/A INTRINSIC
low complexity region 2528 2552 N/A INTRINSIC
low complexity region 2742 2750 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129000
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133283
Meta Mutation Damage Score 0.028 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The product of this gene is a precursor polypeptide that presumably undergoes proteolytic processing to generate the final MAP1A heavy chain and LC2 light chain. Expression of this gene is almost exclusively in the brain. Studies of the rat microtubule-associated protein 1A gene suggested a role in early events of spinal cord development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit Purkinje cell degeneration. Mice homozygous for a spontaneous mutation exhibit mild ataxia and Purkinje cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik A G 12: 55,059,510 S143P possibly damaging Het
4930522H14Rik T C 4: 109,505,457 K218E possibly damaging Het
Abcb1a T A 5: 8,686,300 probably null Het
Adam39 A G 8: 40,824,994 T141A possibly damaging Het
Adam6b T A 12: 113,491,451 S629R probably benign Het
Ap3b2 C A 7: 81,463,690 E924* probably null Het
Armc3 A T 2: 19,310,047 Y856F probably benign Het
Asap1 A G 15: 64,172,730 L142P probably damaging Het
Atg9a T A 1: 75,186,090 D427V probably damaging Het
Atl2 G A 17: 79,852,706 A17V probably benign Het
Atxn2l A T 7: 126,496,467 S379T probably damaging Het
C1ql3 G T 2: 13,010,642 P69Q possibly damaging Het
Cap2 A T 13: 46,609,635 I114F probably damaging Het
Cox16 T C 12: 81,474,615 N135S probably null Het
Dnajc13 A T 9: 104,231,035 H180Q possibly damaging Het
Dpy19l3 A T 7: 35,725,410 Y73* probably null Het
Duox2 T A 2: 122,293,396 M436L probably benign Het
Exoc6 T A 19: 37,597,120 M481K possibly damaging Het
Fbxw2 GCCCCC GCCCCCCCC 2: 34,812,817 probably benign Het
Fmn1 T A 2: 113,365,212 V419E unknown Het
Fndc4 T C 5: 31,293,451 *232W probably null Het
Foxc1 C T 13: 31,808,612 R469* probably null Het
Fsip2 A G 2: 82,979,811 H2158R probably benign Het
Ghdc C T 11: 100,768,257 G373D probably benign Het
Gm10330 A T 12: 23,780,031 S50T probably benign Het
Gm8251 A G 1: 44,057,790 F1383L probably benign Het
Gm8251 T C 1: 44,061,507 I144V probably benign Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Lonrf1 A G 8: 36,222,954 V650A probably damaging Het
Mbd3 C G 10: 80,393,906 D190H probably damaging Het
Mcpt9 T C 14: 56,027,519 K175R probably benign Het
Mia3 A G 1: 183,338,674 S85P probably benign Het
Myrip T C 9: 120,432,529 F403L probably damaging Het
Nox4 A G 7: 87,304,889 Y134C probably damaging Het
Numb A G 12: 83,795,443 L642P probably damaging Het
Pappa A T 4: 65,180,948 Y568F possibly damaging Het
Pdzrn4 T C 15: 92,677,712 L333P probably benign Het
Prl A T 13: 27,057,636 S3C probably damaging Het
Ptprc T C 1: 138,120,086 T60A possibly damaging Het
Rbm10 C T X: 20,637,664 probably benign Het
Slc7a7 C T 14: 54,408,646 R120H probably damaging Het
Smpd1 T C 7: 105,556,554 probably null Het
Spta1 A G 1: 174,231,325 E1942G probably damaging Het
Tmem38a A G 8: 72,579,635 Y66C probably damaging Het
Tnnt1 A T 7: 4,507,525 Y232* probably null Het
Tpte T C 8: 22,349,389 probably null Het
Virma T C 4: 11,521,164 V907A probably damaging Het
Vmn1r174 C T 7: 23,754,556 Q216* probably null Het
Zswim3 T C 2: 164,819,981 V127A probably benign Het
Other mutations in Map1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Map1a APN 2 121299027 missense probably damaging 0.99
IGL00826:Map1a APN 2 121302276 missense possibly damaging 0.87
IGL01476:Map1a APN 2 121305207 missense probably damaging 1.00
IGL02029:Map1a APN 2 121303298 missense possibly damaging 0.57
IGL02100:Map1a APN 2 121302846 missense probably damaging 0.99
IGL02136:Map1a APN 2 121300212 missense probably damaging 1.00
IGL02146:Map1a APN 2 121299446 missense probably damaging 1.00
IGL02264:Map1a APN 2 121307313 missense probably damaging 1.00
IGL02456:Map1a APN 2 121298653 missense probably damaging 1.00
IGL02485:Map1a APN 2 121299288 missense probably damaging 1.00
IGL02535:Map1a APN 2 121302177 nonsense probably null
IGL02628:Map1a APN 2 121300104 missense probably damaging 1.00
IGL02721:Map1a APN 2 121304037 missense probably benign 0.44
IGL03273:Map1a APN 2 121300238 missense probably damaging 1.00
IGL03281:Map1a APN 2 121305060 missense probably damaging 1.00
IGL02991:Map1a UTSW 2 121301610 missense probably damaging 0.99
R0096:Map1a UTSW 2 121301505 missense probably damaging 1.00
R0096:Map1a UTSW 2 121301505 missense probably damaging 1.00
R0218:Map1a UTSW 2 121305425 missense probably benign 0.00
R0363:Map1a UTSW 2 121302044 missense probably damaging 1.00
R0450:Map1a UTSW 2 121305774 missense probably benign 0.27
R0469:Map1a UTSW 2 121305774 missense probably benign 0.27
R0477:Map1a UTSW 2 121302101 missense probably damaging 1.00
R0504:Map1a UTSW 2 121302941 missense probably benign 0.03
R0510:Map1a UTSW 2 121305774 missense probably benign 0.27
R0521:Map1a UTSW 2 121305753 missense probably damaging 1.00
R0601:Map1a UTSW 2 121298602 missense probably damaging 1.00
R0619:Map1a UTSW 2 121305255 missense probably damaging 0.96
R0633:Map1a UTSW 2 121308014 missense probably damaging 1.00
R0652:Map1a UTSW 2 121302783 missense probably benign 0.04
R0893:Map1a UTSW 2 121300533 missense probably damaging 1.00
R0960:Map1a UTSW 2 121301643 missense probably benign 0.16
R1115:Map1a UTSW 2 121307378 splice site probably null
R1166:Map1a UTSW 2 121300260 missense probably damaging 1.00
R1326:Map1a UTSW 2 121306190 nonsense probably null
R1331:Map1a UTSW 2 121306220 nonsense probably null
R1395:Map1a UTSW 2 121303925 missense probably benign 0.26
R1573:Map1a UTSW 2 121304126 missense probably benign 0.37
R1596:Map1a UTSW 2 121289765 missense probably benign 0.00
R1662:Map1a UTSW 2 121306408 missense possibly damaging 0.90
R1675:Map1a UTSW 2 121302655 nonsense probably null
R1919:Map1a UTSW 2 121307012 missense probably damaging 1.00
R2122:Map1a UTSW 2 121299446 missense probably damaging 1.00
R2126:Map1a UTSW 2 121298641 missense probably damaging 0.96
R2143:Map1a UTSW 2 121301945 missense probably damaging 1.00
R2172:Map1a UTSW 2 121307932 missense probably damaging 1.00
R2249:Map1a UTSW 2 121300287 missense probably damaging 1.00
R2254:Map1a UTSW 2 121303791 missense possibly damaging 0.71
R2255:Map1a UTSW 2 121303791 missense possibly damaging 0.71
R3834:Map1a UTSW 2 121307322 missense probably damaging 1.00
R4011:Map1a UTSW 2 121300127 missense probably damaging 1.00
R4346:Map1a UTSW 2 121301325 missense probably benign 0.13
R4842:Map1a UTSW 2 121302086 missense probably damaging 1.00
R4933:Map1a UTSW 2 121305905 missense probably damaging 1.00
R4978:Map1a UTSW 2 121301142 missense probably benign 0.00
R4988:Map1a UTSW 2 121303050 missense probably benign 0.34
R5026:Map1a UTSW 2 121307538 missense possibly damaging 0.83
R5086:Map1a UTSW 2 121304504 missense probably damaging 1.00
R5155:Map1a UTSW 2 121302386 missense probably damaging 1.00
R5232:Map1a UTSW 2 121301985 missense probably damaging 1.00
R5311:Map1a UTSW 2 121302387 missense probably damaging 1.00
R5401:Map1a UTSW 2 121299672 missense probably damaging 1.00
R5465:Map1a UTSW 2 121306025 missense probably damaging 1.00
R5526:Map1a UTSW 2 121305662 missense probably damaging 1.00
R5642:Map1a UTSW 2 121306043 missense probably damaging 1.00
R5726:Map1a UTSW 2 121305065 missense probably damaging 1.00
R5817:Map1a UTSW 2 121298910 missense possibly damaging 0.81
R5855:Map1a UTSW 2 121303674 missense possibly damaging 0.74
R5917:Map1a UTSW 2 121305216 missense probably damaging 1.00
R5974:Map1a UTSW 2 121304376 missense probably benign 0.20
R5987:Map1a UTSW 2 121304295 missense possibly damaging 0.56
R6151:Map1a UTSW 2 121289823 missense probably benign 0.12
R6406:Map1a UTSW 2 121300743 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATCCTGTGGCGACACAGAAGGAC -3'
(R):5'- TTACGGACCTCAGGGGTAAAAGGC -3'

Sequencing Primer
(F):5'- ACAGAAGGACCTGGCTGC -3'
(R):5'- tcctttttctcctccttccttc -3'
Posted On2014-03-28