Incidental Mutation 'R1490:Olfr672'
ID163649
Institutional Source Beutler Lab
Gene Symbol Olfr672
Ensembl Gene ENSMUSG00000051172
Gene Nameolfactory receptor 672
SynonymsMOR32-4, GA_x6K02T2PBJ9-7625746-7624808
MMRRC Submission 039542-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R1490 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location104995760-105002029 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104996493 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 137 (I137T)
Ref Sequence ENSEMBL: ENSMUSP00000149704 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050599] [ENSMUST00000213942]
Predicted Effect possibly damaging
Transcript: ENSMUST00000050599
AA Change: I137T

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000054607
Gene: ENSMUSG00000051172
AA Change: I137T

DomainStartEndE-ValueType
Pfam:7tm_4 33 311 9.1e-111 PFAM
Pfam:7TM_GPCR_Srsx 37 304 4.8e-7 PFAM
Pfam:7tm_1 43 293 5.8e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211761
AA Change: I137T
Predicted Effect possibly damaging
Transcript: ENSMUST00000213942
AA Change: I137T

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025F22Rik A G 19: 11,141,538 I69T probably benign Het
Aldh1l2 G A 10: 83,520,370 T52I probably damaging Het
Arhgef28 G A 13: 97,978,444 R633W probably damaging Het
Atg9a T C 1: 75,185,745 N507S possibly damaging Het
Bsn A G 9: 108,113,994 S1520P probably benign Het
Cacul1 G T 19: 60,580,399 A107E probably damaging Het
Cd74 A G 18: 60,811,366 D216G probably damaging Het
Cdh16 A T 8: 104,622,070 W109R probably damaging Het
Cdip1 C T 16: 4,768,911 V100I probably damaging Het
Ceacam3 A G 7: 17,163,146 D679G probably damaging Het
Comp A G 8: 70,373,913 D46G possibly damaging Het
Dlx3 T C 11: 95,120,604 Y95H probably benign Het
Dmrta2 T C 4: 109,979,875 S5P unknown Het
E130308A19Rik A G 4: 59,719,746 Y426C probably damaging Het
Entpd3 A G 9: 120,554,159 S87G probably benign Het
Eps8l1 A G 7: 4,470,889 R232G probably damaging Het
Gart A T 16: 91,624,344 V812D probably damaging Het
Gm10153 C T 7: 142,190,142 C83Y unknown Het
Gpd2 T C 2: 57,355,475 V394A probably damaging Het
Hpcal1 A T 12: 17,786,224 E18D probably benign Het
Mdga2 T C 12: 66,797,756 D156G probably benign Het
Mks1 A G 11: 87,862,769 K510E probably benign Het
Mtmr4 G A 11: 87,612,225 R1035Q probably damaging Het
Myh6 T A 14: 54,962,718 K235* probably null Het
Nedd1 A G 10: 92,700,798 F214S probably damaging Het
Olfr166 T C 16: 19,486,922 M28T probably benign Het
Olfr392 A G 11: 73,814,371 V237A possibly damaging Het
Olfr98 A G 17: 37,262,842 M274T probably benign Het
Pfkfb2 A C 1: 130,697,889 probably null Het
Pfkfb4 T C 9: 109,027,620 L398P probably damaging Het
Pfn3 T G 13: 55,414,919 D83A probably damaging Het
Pi4ka C A 16: 17,386,268 W54L probably damaging Het
Ppp3r1 A G 11: 17,198,275 D161G probably benign Het
Prrc2a A G 17: 35,153,254 S1757P probably benign Het
Samd7 A G 3: 30,758,353 E314G probably benign Het
Slc17a4 A G 13: 23,904,753 I217T probably benign Het
Slc22a1 A T 17: 12,662,893 probably null Het
Slc7a7 C T 14: 54,408,646 R120H probably damaging Het
Sos1 A T 17: 80,413,675 H905Q probably benign Het
Thada G A 17: 84,446,601 T314I possibly damaging Het
Tirap ACTGCTGCTGCTGCTGCTG ACTGCTGCTGCTGCTG 9: 35,189,066 probably benign Het
Tlr11 A C 14: 50,363,176 H873P probably benign Het
Tlr4 A T 4: 66,839,374 T135S possibly damaging Het
Tmem116 T C 5: 121,495,111 S183P probably damaging Het
Tubgcp3 A T 8: 12,639,550 I572K probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ush2a C T 1: 188,359,841 T523I probably benign Het
Usp40 G A 1: 87,988,965 Q364* probably null Het
Vmn1r61 T C 7: 5,611,243 Q24R probably benign Het
Wdfy4 C A 14: 33,152,538 probably null Het
Zfp458 G A 13: 67,257,509 P286S probably damaging Het
Zfp68 A T 5: 138,606,829 C373S probably benign Het
Zfp768 T A 7: 127,343,631 I442F probably damaging Het
Zfp990 A G 4: 145,537,283 R284G probably benign Het
Other mutations in Olfr672
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Olfr672 APN 7 104996721 missense probably damaging 1.00
PIT4151001:Olfr672 UTSW 7 104996217 missense probably damaging 1.00
R0396:Olfr672 UTSW 7 104996706 missense probably damaging 0.99
R0632:Olfr672 UTSW 7 104996703 missense probably benign 0.00
R1781:Olfr672 UTSW 7 104996108 missense possibly damaging 0.80
R2251:Olfr672 UTSW 7 104996595 missense probably damaging 1.00
R3419:Olfr672 UTSW 7 104996520 missense probably damaging 1.00
R3625:Olfr672 UTSW 7 104995984 missense probably benign 0.17
R4093:Olfr672 UTSW 7 104996635 missense probably benign 0.01
R4620:Olfr672 UTSW 7 104996623 missense probably damaging 1.00
R4890:Olfr672 UTSW 7 104996104 missense probably benign 0.15
R5338:Olfr672 UTSW 7 104996307 missense possibly damaging 0.61
R5934:Olfr672 UTSW 7 104996178 missense probably damaging 1.00
R6712:Olfr672 UTSW 7 104996418 missense possibly damaging 0.92
Z1088:Olfr672 UTSW 7 104996454 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGCTGACACATGCCAGTCGAG -3'
(R):5'- GCACAGCCTTCACCAACCTATGTTC -3'

Sequencing Primer
(F):5'- AGCAATGCCCATGTGCTC -3'
(R):5'- ACTTGGGTCTGTCTACAGCAAC -3'
Posted On2014-03-28