Incidental Mutation 'R1490:Tirap'
ID163655
Institutional Source Beutler Lab
Gene Symbol Tirap
Ensembl Gene ENSMUSG00000032041
Gene Nametoll-interleukin 1 receptor (TIR) domain-containing adaptor protein
SynonymsMal, Mal, wyatt, MyD88-adapter-like, C130027E04Rik
MMRRC Submission 039542-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.218) question?
Stock #R1490 (G1)
Quality Score110
Status Not validated
Chromosome9
Chromosomal Location35184551-35200291 bp(-) (GRCm38)
Type of Mutationsmall deletion (1 aa in frame mutation)
DNA Base Change (assembly) ACTGCTGCTGCTGCTGCTG to ACTGCTGCTGCTGCTG at 35189066 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000175765] [ENSMUST00000176021] [ENSMUST00000176531] [ENSMUST00000176611] [ENSMUST00000176685] [ENSMUST00000177052] [ENSMUST00000177129]
Predicted Effect probably benign
Transcript: ENSMUST00000175765
SMART Domains Protein: ENSMUSP00000135435
Gene: ENSMUSG00000032041

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
low complexity region 65 107 N/A INTRINSIC
Pfam:TIR 113 206 2.4e-8 PFAM
Pfam:TIR_2 116 226 1.9e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176021
SMART Domains Protein: ENSMUSP00000135738
Gene: ENSMUSG00000032041

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
low complexity region 65 107 N/A INTRINSIC
Pfam:TIR 116 215 3.1e-10 PFAM
Pfam:TIR_2 116 219 6.1e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176531
SMART Domains Protein: ENSMUSP00000135224
Gene: ENSMUSG00000032041

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
low complexity region 65 107 N/A INTRINSIC
Pfam:TIR 116 225 2.6e-10 PFAM
Pfam:TIR_2 116 226 1.4e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176611
SMART Domains Protein: ENSMUSP00000134984
Gene: ENSMUSG00000032041

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
low complexity region 65 107 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176685
SMART Domains Protein: ENSMUSP00000135876
Gene: ENSMUSG00000032041

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
low complexity region 65 107 N/A INTRINSIC
Pfam:TIR 116 225 2.6e-10 PFAM
Pfam:TIR_2 116 226 1.4e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177052
Predicted Effect probably benign
Transcript: ENSMUST00000177129
SMART Domains Protein: ENSMUSP00000135462
Gene: ENSMUSG00000032041

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
low complexity region 65 107 N/A INTRINSIC
Pfam:TIR 116 225 2.6e-10 PFAM
Pfam:TIR_2 116 226 1.4e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214606
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The innate immune system recognizes microbial pathogens through Toll-like receptors (TLRs), which identify pathogen-associated molecular patterns. Different TLRs recognize different pathogen-associated molecular patterns and all TLRs have a Toll-interleukin 1 receptor (TIR) domain, which is responsible for signal transduction. The protein encoded by this gene is a TIR adaptor protein involved in the TLR4 signaling pathway of the immune system. It activates NF-kappa-B, MAPK1, MAPK3 and JNK, which then results in cytokine secretion and the inflammatory response. Alternative splicing of this gene results in several transcript variants; however, not all variants have been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene lead to impaired cytokine secretion in response to TLR2 and TLR4 ligands. Homozygous null mice may also show low serum IgG3 levels, a reduced response to attenuated yellow fever vaccine, high susceptibility to bacterial infection, and altered response to myocardial infarction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025F22Rik A G 19: 11,141,538 I69T probably benign Het
Aldh1l2 G A 10: 83,520,370 T52I probably damaging Het
Arhgef28 G A 13: 97,978,444 R633W probably damaging Het
Atg9a T C 1: 75,185,745 N507S possibly damaging Het
Bsn A G 9: 108,113,994 S1520P probably benign Het
Cacul1 G T 19: 60,580,399 A107E probably damaging Het
Cd74 A G 18: 60,811,366 D216G probably damaging Het
Cdh16 A T 8: 104,622,070 W109R probably damaging Het
Cdip1 C T 16: 4,768,911 V100I probably damaging Het
Ceacam3 A G 7: 17,163,146 D679G probably damaging Het
Comp A G 8: 70,373,913 D46G possibly damaging Het
Dlx3 T C 11: 95,120,604 Y95H probably benign Het
Dmrta2 T C 4: 109,979,875 S5P unknown Het
E130308A19Rik A G 4: 59,719,746 Y426C probably damaging Het
Entpd3 A G 9: 120,554,159 S87G probably benign Het
Eps8l1 A G 7: 4,470,889 R232G probably damaging Het
Gart A T 16: 91,624,344 V812D probably damaging Het
Gm10153 C T 7: 142,190,142 C83Y unknown Het
Gpd2 T C 2: 57,355,475 V394A probably damaging Het
Hpcal1 A T 12: 17,786,224 E18D probably benign Het
Mdga2 T C 12: 66,797,756 D156G probably benign Het
Mks1 A G 11: 87,862,769 K510E probably benign Het
Mtmr4 G A 11: 87,612,225 R1035Q probably damaging Het
Myh6 T A 14: 54,962,718 K235* probably null Het
Nedd1 A G 10: 92,700,798 F214S probably damaging Het
Olfr166 T C 16: 19,486,922 M28T probably benign Het
Olfr392 A G 11: 73,814,371 V237A possibly damaging Het
Olfr672 A G 7: 104,996,493 I137T possibly damaging Het
Olfr98 A G 17: 37,262,842 M274T probably benign Het
Pfkfb2 A C 1: 130,697,889 probably null Het
Pfkfb4 T C 9: 109,027,620 L398P probably damaging Het
Pfn3 T G 13: 55,414,919 D83A probably damaging Het
Pi4ka C A 16: 17,386,268 W54L probably damaging Het
Ppp3r1 A G 11: 17,198,275 D161G probably benign Het
Prrc2a A G 17: 35,153,254 S1757P probably benign Het
Samd7 A G 3: 30,758,353 E314G probably benign Het
Slc17a4 A G 13: 23,904,753 I217T probably benign Het
Slc22a1 A T 17: 12,662,893 probably null Het
Slc7a7 C T 14: 54,408,646 R120H probably damaging Het
Sos1 A T 17: 80,413,675 H905Q probably benign Het
Thada G A 17: 84,446,601 T314I possibly damaging Het
Tlr11 A C 14: 50,363,176 H873P probably benign Het
Tlr4 A T 4: 66,839,374 T135S possibly damaging Het
Tmem116 T C 5: 121,495,111 S183P probably damaging Het
Tubgcp3 A T 8: 12,639,550 I572K probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ush2a C T 1: 188,359,841 T523I probably benign Het
Usp40 G A 1: 87,988,965 Q364* probably null Het
Vmn1r61 T C 7: 5,611,243 Q24R probably benign Het
Wdfy4 C A 14: 33,152,538 probably null Het
Zfp458 G A 13: 67,257,509 P286S probably damaging Het
Zfp68 A T 5: 138,606,829 C373S probably benign Het
Zfp768 T A 7: 127,343,631 I442F probably damaging Het
Zfp990 A G 4: 145,537,283 R284G probably benign Het
Other mutations in Tirap
AlleleSourceChrCoordTypePredicted EffectPPH Score
torpid UTSW 9 35198707 intron probably benign
R0084:Tirap UTSW 9 35189162 missense probably benign 0.34
R0184:Tirap UTSW 9 35189194 missense probably benign 0.09
R0594:Tirap UTSW 9 35188761 missense probably damaging 1.00
R1833:Tirap UTSW 9 35188703 missense probably benign 0.19
R1993:Tirap UTSW 9 35191016 critical splice donor site probably null
R5703:Tirap UTSW 9 35188758 missense probably damaging 1.00
R5875:Tirap UTSW 9 35189169 missense probably damaging 0.96
R7257:Tirap UTSW 9 35189034 missense probably damaging 1.00
R7283:Tirap UTSW 9 35188929 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACTTGGTAAAAGCCTCCGTCCTTG -3'
(R):5'- TGGTTCACAGACAGCCACACAG -3'

Sequencing Primer
(F):5'- AGTGACTACGACTCAGTGCC -3'
(R):5'- CCACACAGGATGGTCTCTC -3'
Posted On2014-03-28