Incidental Mutation 'R1490:Olfr392'
ID163663
Institutional Source Beutler Lab
Gene Symbol Olfr392
Ensembl Gene ENSMUSG00000061984
Gene Nameolfactory receptor 392
SynonymsGA_x6K02T2P1NL-3966976-3966038, MOR135-9
MMRRC Submission 039542-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1490 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location73811740-73817049 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73814371 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 237 (V237A)
Ref Sequence ENSEMBL: ENSMUSP00000123649 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118463] [ENSMUST00000144724]
Predicted Effect possibly damaging
Transcript: ENSMUST00000118463
AA Change: V237A

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113118
Gene: ENSMUSG00000061984
AA Change: V237A

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.5e-58 PFAM
Pfam:7TM_GPCR_Srsx 35 305 2.6e-6 PFAM
Pfam:7tm_1 41 290 1.2e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000144724
AA Change: V237A

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000123649
Gene: ENSMUSG00000061984
AA Change: V237A

DomainStartEndE-ValueType
Pfam:7tm_1 41 116 2e-12 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025F22Rik A G 19: 11,141,538 I69T probably benign Het
Aldh1l2 G A 10: 83,520,370 T52I probably damaging Het
Arhgef28 G A 13: 97,978,444 R633W probably damaging Het
Atg9a T C 1: 75,185,745 N507S possibly damaging Het
Bsn A G 9: 108,113,994 S1520P probably benign Het
Cacul1 G T 19: 60,580,399 A107E probably damaging Het
Cd74 A G 18: 60,811,366 D216G probably damaging Het
Cdh16 A T 8: 104,622,070 W109R probably damaging Het
Cdip1 C T 16: 4,768,911 V100I probably damaging Het
Ceacam3 A G 7: 17,163,146 D679G probably damaging Het
Comp A G 8: 70,373,913 D46G possibly damaging Het
Dlx3 T C 11: 95,120,604 Y95H probably benign Het
Dmrta2 T C 4: 109,979,875 S5P unknown Het
E130308A19Rik A G 4: 59,719,746 Y426C probably damaging Het
Entpd3 A G 9: 120,554,159 S87G probably benign Het
Eps8l1 A G 7: 4,470,889 R232G probably damaging Het
Gart A T 16: 91,624,344 V812D probably damaging Het
Gm10153 C T 7: 142,190,142 C83Y unknown Het
Gpd2 T C 2: 57,355,475 V394A probably damaging Het
Hpcal1 A T 12: 17,786,224 E18D probably benign Het
Mdga2 T C 12: 66,797,756 D156G probably benign Het
Mks1 A G 11: 87,862,769 K510E probably benign Het
Mtmr4 G A 11: 87,612,225 R1035Q probably damaging Het
Myh6 T A 14: 54,962,718 K235* probably null Het
Nedd1 A G 10: 92,700,798 F214S probably damaging Het
Olfr166 T C 16: 19,486,922 M28T probably benign Het
Olfr672 A G 7: 104,996,493 I137T possibly damaging Het
Olfr98 A G 17: 37,262,842 M274T probably benign Het
Pfkfb2 A C 1: 130,697,889 probably null Het
Pfkfb4 T C 9: 109,027,620 L398P probably damaging Het
Pfn3 T G 13: 55,414,919 D83A probably damaging Het
Pi4ka C A 16: 17,386,268 W54L probably damaging Het
Ppp3r1 A G 11: 17,198,275 D161G probably benign Het
Prrc2a A G 17: 35,153,254 S1757P probably benign Het
Samd7 A G 3: 30,758,353 E314G probably benign Het
Slc17a4 A G 13: 23,904,753 I217T probably benign Het
Slc22a1 A T 17: 12,662,893 probably null Het
Slc7a7 C T 14: 54,408,646 R120H probably damaging Het
Sos1 A T 17: 80,413,675 H905Q probably benign Het
Thada G A 17: 84,446,601 T314I possibly damaging Het
Tirap ACTGCTGCTGCTGCTGCTG ACTGCTGCTGCTGCTG 9: 35,189,066 probably benign Het
Tlr11 A C 14: 50,363,176 H873P probably benign Het
Tlr4 A T 4: 66,839,374 T135S possibly damaging Het
Tmem116 T C 5: 121,495,111 S183P probably damaging Het
Tubgcp3 A T 8: 12,639,550 I572K probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ush2a C T 1: 188,359,841 T523I probably benign Het
Usp40 G A 1: 87,988,965 Q364* probably null Het
Vmn1r61 T C 7: 5,611,243 Q24R probably benign Het
Wdfy4 C A 14: 33,152,538 probably null Het
Zfp458 G A 13: 67,257,509 P286S probably damaging Het
Zfp68 A T 5: 138,606,829 C373S probably benign Het
Zfp768 T A 7: 127,343,631 I442F probably damaging Het
Zfp990 A G 4: 145,537,283 R284G probably benign Het
Other mutations in Olfr392
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01520:Olfr392 APN 11 73814786 missense probably damaging 0.97
IGL02976:Olfr392 APN 11 73814317 missense probably damaging 0.98
IGL03344:Olfr392 APN 11 73814177 missense probably benign 0.21
R0196:Olfr392 UTSW 11 73814905 missense probably damaging 0.99
R0347:Olfr392 UTSW 11 73814311 missense probably damaging 0.98
R0594:Olfr392 UTSW 11 73814617 missense probably benign 0.12
R0940:Olfr392 UTSW 11 73814224 missense probably damaging 1.00
R1233:Olfr392 UTSW 11 73814350 missense probably damaging 1.00
R1300:Olfr392 UTSW 11 73814246 missense probably benign 0.13
R3111:Olfr392 UTSW 11 73814186 missense probably benign
R4827:Olfr392 UTSW 11 73814721 nonsense probably null
R4852:Olfr392 UTSW 11 73814248 missense probably benign 0.11
R4992:Olfr392 UTSW 11 73814320 missense probably damaging 1.00
R6193:Olfr392 UTSW 11 73814824 missense probably benign
R7201:Olfr392 UTSW 11 73814341 missense probably benign 0.19
R7310:Olfr392 UTSW 11 73814286 missense probably damaging 0.98
X0021:Olfr392 UTSW 11 73814305 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTTGAGCATGGGAGTCACCAATG -3'
(R):5'- AGCATCATGAGCACCAAGCTCTG -3'

Sequencing Primer
(F):5'- TTGTCCCATAGAACAGAGACAC -3'
(R):5'- GGATGTTGACTATATTCCATGCC -3'
Posted On2014-03-28