Incidental Mutation 'R1490:Mks1'
ID163665
Institutional Source Beutler Lab
Gene Symbol Mks1
Ensembl Gene ENSMUSG00000034121
Gene NameMeckel syndrome, type 1
SynonymsB8d3
MMRRC Submission 039542-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1490 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location87853215-87863803 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87862769 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 510 (K510E)
Ref Sequence ENSEMBL: ENSMUSP00000043790 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038196] [ENSMUST00000049768]
Predicted Effect probably benign
Transcript: ENSMUST00000038196
AA Change: K510E

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000043790
Gene: ENSMUSG00000034121
AA Change: K510E

DomainStartEndE-ValueType
low complexity region 163 170 N/A INTRINSIC
Pfam:B9-C2 316 496 1.8e-45 PFAM
low complexity region 533 547 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000049768
SMART Domains Protein: ENSMUSP00000050497
Gene: ENSMUSG00000052234

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:An_peroxidase 146 690 8.3e-184 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130135
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135369
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153729
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene localizes to the basal body and is required for formation of the primary cilium in ciliated epithelial cells. Mutations in this gene result in Meckel syndrome type 1 and in Bardet-Biedl syndrome type 13. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for an ENU-induced or targeted allele exhibit polydactyly, heterotaxia, skeletal defects, and kidney cysts along with abnormal lung, kidney, liver, and heart morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025F22Rik A G 19: 11,141,538 I69T probably benign Het
Aldh1l2 G A 10: 83,520,370 T52I probably damaging Het
Arhgef28 G A 13: 97,978,444 R633W probably damaging Het
Atg9a T C 1: 75,185,745 N507S possibly damaging Het
Bsn A G 9: 108,113,994 S1520P probably benign Het
Cacul1 G T 19: 60,580,399 A107E probably damaging Het
Cd74 A G 18: 60,811,366 D216G probably damaging Het
Cdh16 A T 8: 104,622,070 W109R probably damaging Het
Cdip1 C T 16: 4,768,911 V100I probably damaging Het
Ceacam3 A G 7: 17,163,146 D679G probably damaging Het
Comp A G 8: 70,373,913 D46G possibly damaging Het
Dlx3 T C 11: 95,120,604 Y95H probably benign Het
Dmrta2 T C 4: 109,979,875 S5P unknown Het
E130308A19Rik A G 4: 59,719,746 Y426C probably damaging Het
Entpd3 A G 9: 120,554,159 S87G probably benign Het
Eps8l1 A G 7: 4,470,889 R232G probably damaging Het
Gart A T 16: 91,624,344 V812D probably damaging Het
Gm10153 C T 7: 142,190,142 C83Y unknown Het
Gpd2 T C 2: 57,355,475 V394A probably damaging Het
Hpcal1 A T 12: 17,786,224 E18D probably benign Het
Mdga2 T C 12: 66,797,756 D156G probably benign Het
Mtmr4 G A 11: 87,612,225 R1035Q probably damaging Het
Myh6 T A 14: 54,962,718 K235* probably null Het
Nedd1 A G 10: 92,700,798 F214S probably damaging Het
Olfr166 T C 16: 19,486,922 M28T probably benign Het
Olfr392 A G 11: 73,814,371 V237A possibly damaging Het
Olfr672 A G 7: 104,996,493 I137T possibly damaging Het
Olfr98 A G 17: 37,262,842 M274T probably benign Het
Pfkfb2 A C 1: 130,697,889 probably null Het
Pfkfb4 T C 9: 109,027,620 L398P probably damaging Het
Pfn3 T G 13: 55,414,919 D83A probably damaging Het
Pi4ka C A 16: 17,386,268 W54L probably damaging Het
Ppp3r1 A G 11: 17,198,275 D161G probably benign Het
Prrc2a A G 17: 35,153,254 S1757P probably benign Het
Samd7 A G 3: 30,758,353 E314G probably benign Het
Slc17a4 A G 13: 23,904,753 I217T probably benign Het
Slc22a1 A T 17: 12,662,893 probably null Het
Slc7a7 C T 14: 54,408,646 R120H probably damaging Het
Sos1 A T 17: 80,413,675 H905Q probably benign Het
Thada G A 17: 84,446,601 T314I possibly damaging Het
Tirap ACTGCTGCTGCTGCTGCTG ACTGCTGCTGCTGCTG 9: 35,189,066 probably benign Het
Tlr11 A C 14: 50,363,176 H873P probably benign Het
Tlr4 A T 4: 66,839,374 T135S possibly damaging Het
Tmem116 T C 5: 121,495,111 S183P probably damaging Het
Tubgcp3 A T 8: 12,639,550 I572K probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ush2a C T 1: 188,359,841 T523I probably benign Het
Usp40 G A 1: 87,988,965 Q364* probably null Het
Vmn1r61 T C 7: 5,611,243 Q24R probably benign Het
Wdfy4 C A 14: 33,152,538 probably null Het
Zfp458 G A 13: 67,257,509 P286S probably damaging Het
Zfp68 A T 5: 138,606,829 C373S probably benign Het
Zfp768 T A 7: 127,343,631 I442F probably damaging Het
Zfp990 A G 4: 145,537,283 R284G probably benign Het
Other mutations in Mks1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01799:Mks1 APN 11 87856863 missense probably benign 0.28
IGL02291:Mks1 APN 11 87859667 unclassified probably benign
IGL02406:Mks1 APN 11 87862785 missense probably benign 0.02
IGL02938:Mks1 APN 11 87862652 critical splice donor site probably null
IGL03094:Mks1 APN 11 87855465 splice site probably benign
R0389:Mks1 UTSW 11 87857928 missense probably benign
R0893:Mks1 UTSW 11 87856951 splice site probably benign
R1514:Mks1 UTSW 11 87861111 missense probably benign 0.31
R2042:Mks1 UTSW 11 87856668 splice site probably benign
R4289:Mks1 UTSW 11 87856704 intron probably benign
R4757:Mks1 UTSW 11 87863024 makesense probably null
R4868:Mks1 UTSW 11 87853723 splice site probably benign
R5243:Mks1 UTSW 11 87856678 intron probably benign
R5708:Mks1 UTSW 11 87856839 missense probably benign 0.21
R5848:Mks1 UTSW 11 87856870 missense probably benign 0.00
R6289:Mks1 UTSW 11 87859659 critical splice donor site probably null
R6320:Mks1 UTSW 11 87855499 missense probably benign 0.00
R7205:Mks1 UTSW 11 87856602 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GGTACTGTCACCTTCCGATTGCAC -3'
(R):5'- GGATGCAGACATCTTTCCCTTGCTC -3'

Sequencing Primer
(F):5'- CCGATTGCACTGCCTGC -3'
(R):5'- AACTAGGTCAACGTTCCCGTG -3'
Posted On2014-03-28