Incidental Mutation 'R1490:Pfn3'
ID163671
Institutional Source Beutler Lab
Gene Symbol Pfn3
Ensembl Gene ENSMUSG00000044444
Gene Nameprofilin 3
Synonyms
MMRRC Submission 039542-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R1490 (G1)
Quality Score117
Status Not validated
Chromosome13
Chromosomal Location55414688-55415232 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 55414919 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 83 (D83A)
Ref Sequence ENSEMBL: ENSMUSP00000054053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021948] [ENSMUST00000054146] [ENSMUST00000057167] [ENSMUST00000170921] [ENSMUST00000224925] [ENSMUST00000225259]
Predicted Effect probably benign
Transcript: ENSMUST00000021948
SMART Domains Protein: ENSMUSP00000021948
Gene: ENSMUSG00000021492

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
FN2 40 88 4.3e-24 SMART
EGF 97 131 4.22e-4 SMART
FN1 135 175 2.4e-13 SMART
EGF 177 210 3.94e-4 SMART
KR 215 297 6.88e-27 SMART
low complexity region 302 320 N/A INTRINSIC
Tryp_SPc 354 591 7.74e-90 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000054146
AA Change: D83A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054053
Gene: ENSMUSG00000044444
AA Change: D83A

DomainStartEndE-ValueType
Pfam:Profilin 3 132 7.5e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000057167
SMART Domains Protein: ENSMUSP00000059138
Gene: ENSMUSG00000021490

DomainStartEndE-ValueType
Pfam:Na_Pi_cotrans 113 256 7.4e-28 PFAM
Pfam:Na_Pi_cotrans 359 549 2.3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170921
SMART Domains Protein: ENSMUSP00000125771
Gene: ENSMUSG00000021492

DomainStartEndE-ValueType
Tryp_SPc 2 137 3.4e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223954
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224043
Predicted Effect probably benign
Transcript: ENSMUST00000224925
Predicted Effect probably benign
Transcript: ENSMUST00000225259
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225538
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the profilin family of proteins. This protein binds to actin and affects the structure of the cytoskeleton. It also may be involved in spermatogenesis. It is a single exon gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025F22Rik A G 19: 11,141,538 I69T probably benign Het
Aldh1l2 G A 10: 83,520,370 T52I probably damaging Het
Arhgef28 G A 13: 97,978,444 R633W probably damaging Het
Atg9a T C 1: 75,185,745 N507S possibly damaging Het
Bsn A G 9: 108,113,994 S1520P probably benign Het
Cacul1 G T 19: 60,580,399 A107E probably damaging Het
Cd74 A G 18: 60,811,366 D216G probably damaging Het
Cdh16 A T 8: 104,622,070 W109R probably damaging Het
Cdip1 C T 16: 4,768,911 V100I probably damaging Het
Ceacam3 A G 7: 17,163,146 D679G probably damaging Het
Comp A G 8: 70,373,913 D46G possibly damaging Het
Dlx3 T C 11: 95,120,604 Y95H probably benign Het
Dmrta2 T C 4: 109,979,875 S5P unknown Het
E130308A19Rik A G 4: 59,719,746 Y426C probably damaging Het
Entpd3 A G 9: 120,554,159 S87G probably benign Het
Eps8l1 A G 7: 4,470,889 R232G probably damaging Het
Gart A T 16: 91,624,344 V812D probably damaging Het
Gm10153 C T 7: 142,190,142 C83Y unknown Het
Gpd2 T C 2: 57,355,475 V394A probably damaging Het
Hpcal1 A T 12: 17,786,224 E18D probably benign Het
Mdga2 T C 12: 66,797,756 D156G probably benign Het
Mks1 A G 11: 87,862,769 K510E probably benign Het
Mtmr4 G A 11: 87,612,225 R1035Q probably damaging Het
Myh6 T A 14: 54,962,718 K235* probably null Het
Nedd1 A G 10: 92,700,798 F214S probably damaging Het
Olfr166 T C 16: 19,486,922 M28T probably benign Het
Olfr392 A G 11: 73,814,371 V237A possibly damaging Het
Olfr672 A G 7: 104,996,493 I137T possibly damaging Het
Olfr98 A G 17: 37,262,842 M274T probably benign Het
Pfkfb2 A C 1: 130,697,889 probably null Het
Pfkfb4 T C 9: 109,027,620 L398P probably damaging Het
Pi4ka C A 16: 17,386,268 W54L probably damaging Het
Ppp3r1 A G 11: 17,198,275 D161G probably benign Het
Prrc2a A G 17: 35,153,254 S1757P probably benign Het
Samd7 A G 3: 30,758,353 E314G probably benign Het
Slc17a4 A G 13: 23,904,753 I217T probably benign Het
Slc22a1 A T 17: 12,662,893 probably null Het
Slc7a7 C T 14: 54,408,646 R120H probably damaging Het
Sos1 A T 17: 80,413,675 H905Q probably benign Het
Thada G A 17: 84,446,601 T314I possibly damaging Het
Tirap ACTGCTGCTGCTGCTGCTG ACTGCTGCTGCTGCTG 9: 35,189,066 probably benign Het
Tlr11 A C 14: 50,363,176 H873P probably benign Het
Tlr4 A T 4: 66,839,374 T135S possibly damaging Het
Tmem116 T C 5: 121,495,111 S183P probably damaging Het
Tubgcp3 A T 8: 12,639,550 I572K probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ush2a C T 1: 188,359,841 T523I probably benign Het
Usp40 G A 1: 87,988,965 Q364* probably null Het
Vmn1r61 T C 7: 5,611,243 Q24R probably benign Het
Wdfy4 C A 14: 33,152,538 probably null Het
Zfp458 G A 13: 67,257,509 P286S probably damaging Het
Zfp68 A T 5: 138,606,829 C373S probably benign Het
Zfp768 T A 7: 127,343,631 I442F probably damaging Het
Zfp990 A G 4: 145,537,283 R284G probably benign Het
Other mutations in Pfn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01375:Pfn3 APN 13 55414828 missense possibly damaging 0.86
IGL02126:Pfn3 APN 13 55414886 missense possibly damaging 0.92
R5718:Pfn3 UTSW 13 55415040 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- TCCTACTAAGAGCACTGCTCACGC -3'
(R):5'- AGCACAAGTTGCTGGGACTGACTG -3'

Sequencing Primer
(F):5'- CAGCCCACCAATCAGATCG -3'
(R):5'- CTGGAAGGGCTACATCAGTGC -3'
Posted On2014-03-28