Incidental Mutation 'R1490:Slc7a7'
ID163677
Institutional Source Beutler Lab
Gene Symbol Slc7a7
Ensembl Gene ENSMUSG00000000958
Gene Namesolute carrier family 7 (cationic amino acid transporter, y+ system), member 7
Synonymsmy+lat1
MMRRC Submission 039542-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1490 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location54369442-54417780 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 54408646 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 120 (R120H)
Ref Sequence ENSEMBL: ENSMUSP00000154352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000984] [ENSMUST00000195970] [ENSMUST00000195999] [ENSMUST00000196215] [ENSMUST00000197440] [ENSMUST00000200545] [ENSMUST00000226753] [ENSMUST00000227334] [ENSMUST00000227967] [ENSMUST00000228488]
Predicted Effect probably damaging
Transcript: ENSMUST00000000984
AA Change: R120H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000984
Gene: ENSMUSG00000000958
AA Change: R120H

DomainStartEndE-ValueType
Pfam:AA_permease_2 38 463 2e-64 PFAM
Pfam:AA_permease 43 463 6.3e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000195970
AA Change: R120H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143091
Gene: ENSMUSG00000000958
AA Change: R120H

DomainStartEndE-ValueType
Pfam:AA_permease_2 38 462 6.4e-66 PFAM
Pfam:AA_permease 43 467 5.3e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195999
Predicted Effect probably benign
Transcript: ENSMUST00000196215
SMART Domains Protein: ENSMUSP00000142710
Gene: ENSMUSG00000000958

DomainStartEndE-ValueType
transmembrane domain 38 57 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000197440
AA Change: R120H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143743
Gene: ENSMUSG00000000958
AA Change: R120H

DomainStartEndE-ValueType
Pfam:AA_permease_2 38 463 2e-64 PFAM
Pfam:AA_permease 43 463 6.3e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000200545
AA Change: R120H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142587
Gene: ENSMUSG00000000958
AA Change: R120H

DomainStartEndE-ValueType
Pfam:Trp_Tyr_perm 36 183 7.5e-5 PFAM
Pfam:AA_permease_2 38 186 4.3e-19 PFAM
Pfam:AA_permease 43 185 2.4e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000226753
AA Change: R120H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000227334
AA Change: R120H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000227967
AA Change: R120H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000228488
AA Change: R120H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.0428 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the light subunit of a cationic amino acid transporter. This sodium-independent transporter is formed when the light subunit encoded by this gene dimerizes with the heavy subunit transporter protein SLC3A2. This transporter is found in epithelial cell membranes where it transfers cationic and large neutral amino acids from the cell to the extracellular space. Defects in this gene are a cause of lysinuric protein intolerance (LPI). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2011]
PHENOTYPE: Homozygous null mice exhibit fetal growth retardation and often die neonatally. After heavy protein ingestion, surviving adults show a metabolic derangement akin to lysinuric protein intolerance and including a lasting postnatal growth retardation, splenomegaly, hyperammonemia, and aminoaciduria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025F22Rik A G 19: 11,141,538 I69T probably benign Het
Aldh1l2 G A 10: 83,520,370 T52I probably damaging Het
Arhgef28 G A 13: 97,978,444 R633W probably damaging Het
Atg9a T C 1: 75,185,745 N507S possibly damaging Het
Bsn A G 9: 108,113,994 S1520P probably benign Het
Cacul1 G T 19: 60,580,399 A107E probably damaging Het
Cd74 A G 18: 60,811,366 D216G probably damaging Het
Cdh16 A T 8: 104,622,070 W109R probably damaging Het
Cdip1 C T 16: 4,768,911 V100I probably damaging Het
Ceacam3 A G 7: 17,163,146 D679G probably damaging Het
Comp A G 8: 70,373,913 D46G possibly damaging Het
Dlx3 T C 11: 95,120,604 Y95H probably benign Het
Dmrta2 T C 4: 109,979,875 S5P unknown Het
E130308A19Rik A G 4: 59,719,746 Y426C probably damaging Het
Entpd3 A G 9: 120,554,159 S87G probably benign Het
Eps8l1 A G 7: 4,470,889 R232G probably damaging Het
Gart A T 16: 91,624,344 V812D probably damaging Het
Gm10153 C T 7: 142,190,142 C83Y unknown Het
Gpd2 T C 2: 57,355,475 V394A probably damaging Het
Hpcal1 A T 12: 17,786,224 E18D probably benign Het
Mdga2 T C 12: 66,797,756 D156G probably benign Het
Mks1 A G 11: 87,862,769 K510E probably benign Het
Mtmr4 G A 11: 87,612,225 R1035Q probably damaging Het
Myh6 T A 14: 54,962,718 K235* probably null Het
Nedd1 A G 10: 92,700,798 F214S probably damaging Het
Olfr166 T C 16: 19,486,922 M28T probably benign Het
Olfr392 A G 11: 73,814,371 V237A possibly damaging Het
Olfr672 A G 7: 104,996,493 I137T possibly damaging Het
Olfr98 A G 17: 37,262,842 M274T probably benign Het
Pfkfb2 A C 1: 130,697,889 probably null Het
Pfkfb4 T C 9: 109,027,620 L398P probably damaging Het
Pfn3 T G 13: 55,414,919 D83A probably damaging Het
Pi4ka C A 16: 17,386,268 W54L probably damaging Het
Ppp3r1 A G 11: 17,198,275 D161G probably benign Het
Prrc2a A G 17: 35,153,254 S1757P probably benign Het
Samd7 A G 3: 30,758,353 E314G probably benign Het
Slc17a4 A G 13: 23,904,753 I217T probably benign Het
Slc22a1 A T 17: 12,662,893 probably null Het
Sos1 A T 17: 80,413,675 H905Q probably benign Het
Thada G A 17: 84,446,601 T314I possibly damaging Het
Tirap ACTGCTGCTGCTGCTGCTG ACTGCTGCTGCTGCTG 9: 35,189,066 probably benign Het
Tlr11 A C 14: 50,363,176 H873P probably benign Het
Tlr4 A T 4: 66,839,374 T135S possibly damaging Het
Tmem116 T C 5: 121,495,111 S183P probably damaging Het
Tubgcp3 A T 8: 12,639,550 I572K probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ush2a C T 1: 188,359,841 T523I probably benign Het
Usp40 G A 1: 87,988,965 Q364* probably null Het
Vmn1r61 T C 7: 5,611,243 Q24R probably benign Het
Wdfy4 C A 14: 33,152,538 probably null Het
Zfp458 G A 13: 67,257,509 P286S probably damaging Het
Zfp68 A T 5: 138,606,829 C373S probably benign Het
Zfp768 T A 7: 127,343,631 I442F probably damaging Het
Zfp990 A G 4: 145,537,283 R284G probably benign Het
Other mutations in Slc7a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0200:Slc7a7 UTSW 14 54377802 missense probably damaging 1.00
R0331:Slc7a7 UTSW 14 54377924 unclassified probably benign
R0608:Slc7a7 UTSW 14 54377802 missense probably damaging 1.00
R1311:Slc7a7 UTSW 14 54373030 nonsense probably null
R1489:Slc7a7 UTSW 14 54408646 missense probably damaging 1.00
R4049:Slc7a7 UTSW 14 54373091 critical splice acceptor site probably null
R4731:Slc7a7 UTSW 14 54408733 missense probably damaging 1.00
R4732:Slc7a7 UTSW 14 54408733 missense probably damaging 1.00
R4733:Slc7a7 UTSW 14 54408733 missense probably damaging 1.00
R5562:Slc7a7 UTSW 14 54408812 missense probably benign
R5745:Slc7a7 UTSW 14 54377835 missense possibly damaging 0.46
R5907:Slc7a7 UTSW 14 54379103 missense probably damaging 1.00
R6140:Slc7a7 UTSW 14 54379058 missense probably damaging 1.00
R6366:Slc7a7 UTSW 14 54374600 missense probably damaging 1.00
R6696:Slc7a7 UTSW 14 54377761 splice site probably null
R6776:Slc7a7 UTSW 14 54374651 missense possibly damaging 0.95
R7310:Slc7a7 UTSW 14 54379025 missense probably damaging 0.99
R7399:Slc7a7 UTSW 14 54374268 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TCTACTTACAGATGCAGGCAGCGG -3'
(R):5'- TCAACAGCACCAAGTATGAAGTGGC -3'

Sequencing Primer
(F):5'- TAGTTGGCAAAGGTGATGGC -3'
(R):5'- AGATCTCCCTGCTTAATGGCG -3'
Posted On2014-03-28