Incidental Mutation 'R1490:Olfr166'
ID163681
Institutional Source Beutler Lab
Gene Symbol Olfr166
Ensembl Gene ENSMUSG00000056822
Gene Nameolfactory receptor 166
SynonymsGA_x54KRFPKG5P-15934912-15935850, MOR270-1
MMRRC Submission 039542-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R1490 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location19483694-19489882 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 19486922 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 28 (M28T)
Ref Sequence ENSEMBL: ENSMUSP00000150764 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074739] [ENSMUST00000213531] [ENSMUST00000216465]
Predicted Effect probably benign
Transcript: ENSMUST00000074739
AA Change: M28T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000074299
Gene: ENSMUSG00000056822
AA Change: M28T

DomainStartEndE-ValueType
low complexity region 12 29 N/A INTRINSIC
Pfam:7tm_4 30 306 4e-50 PFAM
Pfam:7TM_GPCR_Srsx 33 295 3.6e-7 PFAM
Pfam:7tm_1 40 289 2.1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213531
AA Change: M28T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000216465
AA Change: M28T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025F22Rik A G 19: 11,141,538 I69T probably benign Het
Aldh1l2 G A 10: 83,520,370 T52I probably damaging Het
Arhgef28 G A 13: 97,978,444 R633W probably damaging Het
Atg9a T C 1: 75,185,745 N507S possibly damaging Het
Bsn A G 9: 108,113,994 S1520P probably benign Het
Cacul1 G T 19: 60,580,399 A107E probably damaging Het
Cd74 A G 18: 60,811,366 D216G probably damaging Het
Cdh16 A T 8: 104,622,070 W109R probably damaging Het
Cdip1 C T 16: 4,768,911 V100I probably damaging Het
Ceacam3 A G 7: 17,163,146 D679G probably damaging Het
Comp A G 8: 70,373,913 D46G possibly damaging Het
Dlx3 T C 11: 95,120,604 Y95H probably benign Het
Dmrta2 T C 4: 109,979,875 S5P unknown Het
E130308A19Rik A G 4: 59,719,746 Y426C probably damaging Het
Entpd3 A G 9: 120,554,159 S87G probably benign Het
Eps8l1 A G 7: 4,470,889 R232G probably damaging Het
Gart A T 16: 91,624,344 V812D probably damaging Het
Gm10153 C T 7: 142,190,142 C83Y unknown Het
Gpd2 T C 2: 57,355,475 V394A probably damaging Het
Hpcal1 A T 12: 17,786,224 E18D probably benign Het
Mdga2 T C 12: 66,797,756 D156G probably benign Het
Mks1 A G 11: 87,862,769 K510E probably benign Het
Mtmr4 G A 11: 87,612,225 R1035Q probably damaging Het
Myh6 T A 14: 54,962,718 K235* probably null Het
Nedd1 A G 10: 92,700,798 F214S probably damaging Het
Olfr392 A G 11: 73,814,371 V237A possibly damaging Het
Olfr672 A G 7: 104,996,493 I137T possibly damaging Het
Olfr98 A G 17: 37,262,842 M274T probably benign Het
Pfkfb2 A C 1: 130,697,889 probably null Het
Pfkfb4 T C 9: 109,027,620 L398P probably damaging Het
Pfn3 T G 13: 55,414,919 D83A probably damaging Het
Pi4ka C A 16: 17,386,268 W54L probably damaging Het
Ppp3r1 A G 11: 17,198,275 D161G probably benign Het
Prrc2a A G 17: 35,153,254 S1757P probably benign Het
Samd7 A G 3: 30,758,353 E314G probably benign Het
Slc17a4 A G 13: 23,904,753 I217T probably benign Het
Slc22a1 A T 17: 12,662,893 probably null Het
Slc7a7 C T 14: 54,408,646 R120H probably damaging Het
Sos1 A T 17: 80,413,675 H905Q probably benign Het
Thada G A 17: 84,446,601 T314I possibly damaging Het
Tirap ACTGCTGCTGCTGCTGCTG ACTGCTGCTGCTGCTG 9: 35,189,066 probably benign Het
Tlr11 A C 14: 50,363,176 H873P probably benign Het
Tlr4 A T 4: 66,839,374 T135S possibly damaging Het
Tmem116 T C 5: 121,495,111 S183P probably damaging Het
Tubgcp3 A T 8: 12,639,550 I572K probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ush2a C T 1: 188,359,841 T523I probably benign Het
Usp40 G A 1: 87,988,965 Q364* probably null Het
Vmn1r61 T C 7: 5,611,243 Q24R probably benign Het
Wdfy4 C A 14: 33,152,538 probably null Het
Zfp458 G A 13: 67,257,509 P286S probably damaging Het
Zfp68 A T 5: 138,606,829 C373S probably benign Het
Zfp768 T A 7: 127,343,631 I442F probably damaging Het
Zfp990 A G 4: 145,537,283 R284G probably benign Het
Other mutations in Olfr166
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01559:Olfr166 APN 16 19487459 missense probably benign 0.13
IGL01639:Olfr166 APN 16 19487164 missense probably damaging 0.97
IGL02105:Olfr166 APN 16 19487261 missense probably benign 0.15
IGL02352:Olfr166 APN 16 19487177 missense probably damaging 1.00
IGL02359:Olfr166 APN 16 19487177 missense probably damaging 1.00
IGL03053:Olfr166 APN 16 19487219 missense probably benign 0.36
IGL03168:Olfr166 APN 16 19487219 missense probably benign 0.36
R0576:Olfr166 UTSW 16 19487188 missense probably damaging 1.00
R0920:Olfr166 UTSW 16 19486930 missense probably benign 0.00
R1335:Olfr166 UTSW 16 19487053 missense probably benign 0.01
R1468:Olfr166 UTSW 16 19487628 missense probably benign 0.15
R1468:Olfr166 UTSW 16 19487628 missense probably benign 0.15
R2095:Olfr166 UTSW 16 19486931 missense probably benign
R3123:Olfr166 UTSW 16 19487015 missense probably damaging 1.00
R4893:Olfr166 UTSW 16 19486903 missense probably benign
R5093:Olfr166 UTSW 16 19487477 missense probably damaging 1.00
R5222:Olfr166 UTSW 16 19486930 missense probably benign
R7149:Olfr166 UTSW 16 19487510 missense probably damaging 1.00
R7305:Olfr166 UTSW 16 19487699 missense probably damaging 0.98
R7484:Olfr166 UTSW 16 19487003 missense possibly damaging 0.82
X0020:Olfr166 UTSW 16 19487090 missense probably benign 0.22
Z1088:Olfr166 UTSW 16 19487048 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- GTGTTAGCCATCTTGCTCATGTTGC -3'
(R):5'- GCCCTCAGAACATGCCATAGTCAG -3'

Sequencing Primer
(F):5'- CATTTCAGTACAAGTGAGTTCCTC -3'
(R):5'- AGAAGGATTGCACTCCACAG -3'
Posted On2014-03-28