Incidental Mutation 'R1490:Gart'
ID163682
Institutional Source Beutler Lab
Gene Symbol Gart
Ensembl Gene ENSMUSG00000022962
Gene Namephosphoribosylglycinamide formyltransferase
SynonymsGaps, Prgs
MMRRC Submission 039542-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1490 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location91621186-91646952 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 91624344 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 812 (V812D)
Ref Sequence ENSEMBL: ENSMUSP00000156002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023684] [ENSMUST00000156713] [ENSMUST00000232289] [ENSMUST00000232640]
Predicted Effect probably damaging
Transcript: ENSMUST00000023684
AA Change: V812D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023684
Gene: ENSMUSG00000022962
AA Change: V812D

DomainStartEndE-ValueType
Pfam:GARS_N 3 104 6.4e-37 PFAM
GARS_A 105 298 4.42e-132 SMART
GARS_C 333 426 1.33e-44 SMART
Pfam:AIRS 473 593 1.2e-17 PFAM
Pfam:AIRS_C 606 777 9e-40 PFAM
Pfam:Formyl_trans_N 808 988 3.4e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138207
Predicted Effect probably benign
Transcript: ENSMUST00000156713
SMART Domains Protein: ENSMUSP00000119272
Gene: ENSMUSG00000022962

DomainStartEndE-ValueType
Pfam:GARS_N 3 104 1.4e-40 PFAM
GARS_A 105 298 4.42e-132 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000232289
AA Change: V812D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232620
Predicted Effect probably benign
Transcript: ENSMUST00000232640
Predicted Effect probably benign
Transcript: ENSMUST00000232643
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a trifunctional polypeptide. It has phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase activity which is required for de novo purine biosynthesis. This enzyme is highly conserved in vertebrates. Alternative splicing of this gene results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025F22Rik A G 19: 11,141,538 I69T probably benign Het
Aldh1l2 G A 10: 83,520,370 T52I probably damaging Het
Arhgef28 G A 13: 97,978,444 R633W probably damaging Het
Atg9a T C 1: 75,185,745 N507S possibly damaging Het
Bsn A G 9: 108,113,994 S1520P probably benign Het
Cacul1 G T 19: 60,580,399 A107E probably damaging Het
Cd74 A G 18: 60,811,366 D216G probably damaging Het
Cdh16 A T 8: 104,622,070 W109R probably damaging Het
Cdip1 C T 16: 4,768,911 V100I probably damaging Het
Ceacam3 A G 7: 17,163,146 D679G probably damaging Het
Comp A G 8: 70,373,913 D46G possibly damaging Het
Dlx3 T C 11: 95,120,604 Y95H probably benign Het
Dmrta2 T C 4: 109,979,875 S5P unknown Het
E130308A19Rik A G 4: 59,719,746 Y426C probably damaging Het
Entpd3 A G 9: 120,554,159 S87G probably benign Het
Eps8l1 A G 7: 4,470,889 R232G probably damaging Het
Gm10153 C T 7: 142,190,142 C83Y unknown Het
Gpd2 T C 2: 57,355,475 V394A probably damaging Het
Hpcal1 A T 12: 17,786,224 E18D probably benign Het
Mdga2 T C 12: 66,797,756 D156G probably benign Het
Mks1 A G 11: 87,862,769 K510E probably benign Het
Mtmr4 G A 11: 87,612,225 R1035Q probably damaging Het
Myh6 T A 14: 54,962,718 K235* probably null Het
Nedd1 A G 10: 92,700,798 F214S probably damaging Het
Olfr166 T C 16: 19,486,922 M28T probably benign Het
Olfr392 A G 11: 73,814,371 V237A possibly damaging Het
Olfr672 A G 7: 104,996,493 I137T possibly damaging Het
Olfr98 A G 17: 37,262,842 M274T probably benign Het
Pfkfb2 A C 1: 130,697,889 probably null Het
Pfkfb4 T C 9: 109,027,620 L398P probably damaging Het
Pfn3 T G 13: 55,414,919 D83A probably damaging Het
Pi4ka C A 16: 17,386,268 W54L probably damaging Het
Ppp3r1 A G 11: 17,198,275 D161G probably benign Het
Prrc2a A G 17: 35,153,254 S1757P probably benign Het
Samd7 A G 3: 30,758,353 E314G probably benign Het
Slc17a4 A G 13: 23,904,753 I217T probably benign Het
Slc22a1 A T 17: 12,662,893 probably null Het
Slc7a7 C T 14: 54,408,646 R120H probably damaging Het
Sos1 A T 17: 80,413,675 H905Q probably benign Het
Thada G A 17: 84,446,601 T314I possibly damaging Het
Tirap ACTGCTGCTGCTGCTGCTG ACTGCTGCTGCTGCTG 9: 35,189,066 probably benign Het
Tlr11 A C 14: 50,363,176 H873P probably benign Het
Tlr4 A T 4: 66,839,374 T135S possibly damaging Het
Tmem116 T C 5: 121,495,111 S183P probably damaging Het
Tubgcp3 A T 8: 12,639,550 I572K probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ush2a C T 1: 188,359,841 T523I probably benign Het
Usp40 G A 1: 87,988,965 Q364* probably null Het
Vmn1r61 T C 7: 5,611,243 Q24R probably benign Het
Wdfy4 C A 14: 33,152,538 probably null Het
Zfp458 G A 13: 67,257,509 P286S probably damaging Het
Zfp68 A T 5: 138,606,829 C373S probably benign Het
Zfp768 T A 7: 127,343,631 I442F probably damaging Het
Zfp990 A G 4: 145,537,283 R284G probably benign Het
Other mutations in Gart
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00597:Gart APN 16 91638789 missense possibly damaging 0.58
IGL00837:Gart APN 16 91638720 unclassified probably benign
IGL01010:Gart APN 16 91643092 nonsense probably null
IGL01064:Gart APN 16 91623007 missense probably damaging 1.00
IGL01451:Gart APN 16 91625512 missense probably benign
IGL02084:Gart APN 16 91621600 missense probably benign
IGL02301:Gart APN 16 91621837 splice site probably benign
IGL02814:Gart APN 16 91623457 missense possibly damaging 0.58
sylvester UTSW 16 91630602 splice site probably benign
PIT4453001:Gart UTSW 16 91636538 missense probably damaging 1.00
R0137:Gart UTSW 16 91625394 missense probably benign
R0197:Gart UTSW 16 91623403 missense possibly damaging 0.95
R0321:Gart UTSW 16 91623037 unclassified probably benign
R0322:Gart UTSW 16 91623037 unclassified probably benign
R0398:Gart UTSW 16 91639449 missense probably damaging 1.00
R0410:Gart UTSW 16 91641327 missense probably damaging 1.00
R0496:Gart UTSW 16 91623037 unclassified probably benign
R0620:Gart UTSW 16 91630602 splice site probably benign
R0628:Gart UTSW 16 91633902 missense probably benign 0.01
R0883:Gart UTSW 16 91623403 missense possibly damaging 0.95
R1346:Gart UTSW 16 91628182 splice site probably null
R1686:Gart UTSW 16 91625349 missense probably damaging 1.00
R1751:Gart UTSW 16 91642949 splice site probably benign
R1917:Gart UTSW 16 91628149 missense probably damaging 1.00
R2144:Gart UTSW 16 91630081 missense probably damaging 1.00
R2421:Gart UTSW 16 91643040 unclassified probably null
R4305:Gart UTSW 16 91633992 missense possibly damaging 0.48
R4377:Gart UTSW 16 91634094 missense probably benign 0.31
R4599:Gart UTSW 16 91622945 nonsense probably null
R4619:Gart UTSW 16 91625433 missense probably damaging 1.00
R4620:Gart UTSW 16 91625433 missense probably damaging 1.00
R5112:Gart UTSW 16 91634045 missense probably benign 0.02
R5902:Gart UTSW 16 91628527 missense probably damaging 1.00
R5975:Gart UTSW 16 91624336 missense probably damaging 1.00
R6736:Gart UTSW 16 91636107 missense probably benign 0.21
R7041:Gart UTSW 16 91643143 start gained probably benign
R7150:Gart UTSW 16 91628463 missense possibly damaging 0.69
R7320:Gart UTSW 16 91621681 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCGATTCTGAAAGCCAACAGCAAA -3'
(R):5'- TGCTGATACAGTAGCTCCTAGTTGAAGT -3'

Sequencing Primer
(F):5'- ggaatctgcctgcctctg -3'
(R):5'- AGAGATGGTAAATGTTATTAACCTGG -3'
Posted On2014-03-28