Incidental Mutation 'R1491:Arhgap24'
ID163730
Institutional Source Beutler Lab
Gene Symbol Arhgap24
Ensembl Gene ENSMUSG00000057315
Gene NameRho GTPase activating protein 24
Synonyms0610025G21Rik
MMRRC Submission 039543-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1491 (G1)
Quality Score182
Status Not validated
Chromosome5
Chromosomal Location102481391-102897937 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102860332 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 40 (I40V)
Ref Sequence ENSEMBL: ENSMUSP00000070048 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070000] [ENSMUST00000073302] [ENSMUST00000094559] [ENSMUST00000112852] [ENSMUST00000112853] [ENSMUST00000112854]
Predicted Effect possibly damaging
Transcript: ENSMUST00000070000
AA Change: I40V

PolyPhen 2 Score 0.471 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000070048
Gene: ENSMUSG00000057315
AA Change: I40V

DomainStartEndE-ValueType
RhoGAP 58 234 7.04e-67 SMART
low complexity region 476 487 N/A INTRINSIC
low complexity region 520 539 N/A INTRINSIC
coiled coil region 558 638 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073302
AA Change: I37V

PolyPhen 2 Score 0.269 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000073028
Gene: ENSMUSG00000057315
AA Change: I37V

DomainStartEndE-ValueType
Blast:RhoGAP 1 38 5e-16 BLAST
RhoGAP 55 231 7.04e-67 SMART
low complexity region 473 484 N/A INTRINSIC
low complexity region 517 536 N/A INTRINSIC
coiled coil region 555 635 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094559
AA Change: I130V

PolyPhen 2 Score 0.152 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000092138
Gene: ENSMUSG00000057315
AA Change: I130V

DomainStartEndE-ValueType
PH 18 125 5.35e-23 SMART
RhoGAP 148 324 7.04e-67 SMART
low complexity region 566 577 N/A INTRINSIC
low complexity region 610 629 N/A INTRINSIC
coiled coil region 648 728 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112852
AA Change: I37V

PolyPhen 2 Score 0.269 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000108473
Gene: ENSMUSG00000057315
AA Change: I37V

DomainStartEndE-ValueType
Blast:RhoGAP 1 38 5e-16 BLAST
RhoGAP 55 231 7.04e-67 SMART
low complexity region 473 484 N/A INTRINSIC
low complexity region 517 536 N/A INTRINSIC
coiled coil region 555 635 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112853
AA Change: I37V

PolyPhen 2 Score 0.269 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000108474
Gene: ENSMUSG00000057315
AA Change: I37V

DomainStartEndE-ValueType
Blast:RhoGAP 1 38 5e-16 BLAST
RhoGAP 55 231 7.04e-67 SMART
low complexity region 473 484 N/A INTRINSIC
low complexity region 517 536 N/A INTRINSIC
coiled coil region 555 635 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112854
AA Change: I37V

PolyPhen 2 Score 0.269 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000108475
Gene: ENSMUSG00000057315
AA Change: I37V

DomainStartEndE-ValueType
Blast:RhoGAP 1 38 5e-16 BLAST
RhoGAP 55 231 7.04e-67 SMART
low complexity region 473 484 N/A INTRINSIC
low complexity region 517 536 N/A INTRINSIC
coiled coil region 555 635 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130222
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 90.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Rho-GTPase activating protein, which is specific for the small GTPase family member Rac. Binding of the encoded protein by filamin A targets it to sites of membrane protrusion, where it antognizes Rac. This results in suppression of lamellae formation and promotion of retraction to regulate cell polarity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730018C14Rik T A 12: 112,415,055 noncoding transcript Het
Acss3 A G 10: 106,937,308 S606P probably benign Het
Adamts13 C T 2: 26,978,315 T146M probably damaging Het
Adora2b G A 11: 62,265,537 V271M probably benign Het
Agpat5 A G 8: 18,846,723 Y55C probably damaging Het
AI987944 A C 7: 41,374,348 Y402* probably null Het
Angptl4 C T 17: 33,781,191 A68T possibly damaging Het
Ankmy1 T C 1: 92,886,809 I325M probably benign Het
Arfgap2 A G 2: 91,274,859 K423E probably damaging Het
Arfgef3 A T 10: 18,646,554 S575T probably damaging Het
Arhgef7 T C 8: 11,819,733 probably null Het
Arid1a C A 4: 133,720,926 S477I unknown Het
Armc7 T C 11: 115,476,203 V58A probably damaging Het
Arrdc5 A T 17: 56,294,222 I301N probably damaging Het
Capn15 G A 17: 25,964,479 P343S probably damaging Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Cgn C T 3: 94,763,228 R1002Q probably damaging Het
Clstn3 A T 6: 124,437,490 I759N possibly damaging Het
Cops5 A G 1: 10,034,018 V166A possibly damaging Het
Cramp1l G T 17: 24,972,349 T1046K probably benign Het
Cthrc1 T G 15: 39,086,677 V143G probably damaging Het
Cul9 G A 17: 46,538,564 Q552* probably null Het
Cyp27b1 A T 10: 127,051,088 D391V probably damaging Het
Dcun1d2 A G 8: 13,281,040 L30S probably damaging Het
Dsc3 T C 18: 19,987,034 E189G probably damaging Het
Dst T G 1: 34,154,594 S295A probably damaging Het
Dusp22 A G 13: 30,708,815 T192A probably benign Het
Esp24 A T 17: 39,038,285 M1L probably null Het
Evc2 G A 5: 37,393,197 probably null Het
Fgd6 A G 10: 94,044,832 N516S probably benign Het
Fmn1 T C 2: 113,596,369 Y1144H probably damaging Het
Fut8 T A 12: 77,448,674 I346K possibly damaging Het
Gata3 A C 2: 9,877,390 V32G probably damaging Het
Glrb A T 3: 80,911,975 C39S possibly damaging Het
Gm16432 C T 1: 178,015,929 T69I possibly damaging Het
Gpr171 A G 3: 59,097,595 V253A probably benign Het
Hdac5 A G 11: 102,201,253 V670A probably benign Het
Hmgxb3 T C 18: 61,133,908 S1085G probably benign Het
Hspa4l A G 3: 40,786,794 N746S probably benign Het
Hyal5 A G 6: 24,877,903 T333A probably benign Het
Ippk T C 13: 49,461,593 V484A probably benign Het
Jmjd8 A T 17: 25,829,292 T33S possibly damaging Het
Kctd19 T A 8: 105,387,062 I660L possibly damaging Het
Lrat A G 3: 82,903,342 V124A probably benign Het
Madcam1 A G 10: 79,666,524 I281V probably benign Het
Mast2 T A 4: 116,316,491 I455F possibly damaging Het
Mroh7 A G 4: 106,703,058 L683P probably benign Het
Myo15b C A 11: 115,886,857 probably null Het
Ncam1 T C 9: 49,505,549 E814G probably benign Het
Ncoa3 A G 2: 166,055,262 T658A probably benign Het
Olfr459 T C 6: 41,771,522 Y259C possibly damaging Het
Olfr53 T G 7: 140,652,737 Y253D probably damaging Het
P2ry13 T C 3: 59,209,518 K280E probably damaging Het
Paqr8 C A 1: 20,934,824 F67L probably benign Het
Pfkfb3 G T 2: 11,493,936 R37S probably damaging Het
Phf14 A G 6: 11,941,479 D310G possibly damaging Het
Phkb A G 8: 85,875,657 S26G possibly damaging Het
Pkd1l2 T A 8: 117,028,408 I1684F probably damaging Het
Plod2 T C 9: 92,606,584 V621A probably benign Het
Plvap T C 8: 71,511,472 N82S probably damaging Het
Pomgnt2 A G 9: 121,982,260 V485A probably damaging Het
Psmd9 A G 5: 123,228,347 E14G probably benign Het
Pwwp2b A G 7: 139,255,963 E440G probably damaging Het
Rasgrp1 G A 2: 117,282,619 Q771* probably null Het
Rft1 C T 14: 30,666,787 Q223* probably null Het
Rgs22 C A 15: 36,092,901 V409F probably damaging Het
Rgsl1 G A 1: 153,825,926 P261S possibly damaging Het
Rpl7a A G 2: 26,911,115 N38S probably damaging Het
Sh3rf2 T A 18: 42,053,939 F41Y probably damaging Het
Spata6 T A 4: 111,746,191 S34R probably damaging Het
Sult2a3 A T 7: 14,122,942 Y18N probably benign Het
Tapt1 A G 5: 44,218,102 probably null Het
Tex2 A T 11: 106,503,640 C615S possibly damaging Het
Trim43b T C 9: 89,087,612 K261R possibly damaging Het
Unc5c T A 3: 141,789,822 M484K probably damaging Het
Vezf1 T A 11: 88,073,747 S242T probably damaging Het
Vmn2r1 A G 3: 64,089,613 Y230C probably damaging Het
Vmn2r94 A G 17: 18,257,703 S149P probably damaging Het
Wfdc1 T A 8: 119,666,666 probably null Het
Zfp975 T C 7: 42,662,812 T126A probably benign Het
Zmym4 T C 4: 126,882,312 probably null Het
Other mutations in Arhgap24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Arhgap24 APN 5 102860399 missense possibly damaging 0.94
IGL01483:Arhgap24 APN 5 102860377 missense possibly damaging 0.91
IGL02641:Arhgap24 APN 5 102892520 missense probably damaging 1.00
IGL03166:Arhgap24 APN 5 102875686 splice site probably benign
R0506:Arhgap24 UTSW 5 102875777 missense probably damaging 0.99
R0606:Arhgap24 UTSW 5 102897220 missense probably damaging 1.00
R1457:Arhgap24 UTSW 5 102664106 missense probably damaging 0.98
R1707:Arhgap24 UTSW 5 102892087 missense probably benign 0.40
R2112:Arhgap24 UTSW 5 102892500 missense probably damaging 1.00
R2300:Arhgap24 UTSW 5 102860425 missense probably damaging 1.00
R2516:Arhgap24 UTSW 5 102891910 missense probably benign
R3803:Arhgap24 UTSW 5 102892442 missense probably damaging 0.98
R4257:Arhgap24 UTSW 5 102664117 missense probably benign 0.00
R4761:Arhgap24 UTSW 5 102664214 intron probably benign
R5045:Arhgap24 UTSW 5 102891877 missense possibly damaging 0.79
R5121:Arhgap24 UTSW 5 102841335 missense probably damaging 1.00
R5209:Arhgap24 UTSW 5 102892149 missense probably benign 0.12
R5667:Arhgap24 UTSW 5 102846171 critical splice donor site probably null
R5914:Arhgap24 UTSW 5 102552159 intron probably null
R6039:Arhgap24 UTSW 5 102880786 missense probably damaging 0.98
R6039:Arhgap24 UTSW 5 102880786 missense probably damaging 0.98
R6158:Arhgap24 UTSW 5 102892912 missense probably benign 0.12
R6410:Arhgap24 UTSW 5 102892151 missense probably benign 0.10
R6450:Arhgap24 UTSW 5 102897124 missense probably benign 0.01
R6520:Arhgap24 UTSW 5 102880793 missense probably benign 0.00
R6666:Arhgap24 UTSW 5 102552297 intron probably null
R7233:Arhgap24 UTSW 5 102878501 missense probably benign 0.03
R7311:Arhgap24 UTSW 5 102892685 missense probably damaging 1.00
R7460:Arhgap24 UTSW 5 102892346 missense probably benign 0.36
R7483:Arhgap24 UTSW 5 102841308 missense probably benign 0.13
R7515:Arhgap24 UTSW 5 102846016 intron probably benign
Predicted Primers PCR Primer
(F):5'- CTTGAGCCTTGCACAATTTCCACG -3'
(R):5'- GCCTGTCCAACATACCTGTCGAAG -3'

Sequencing Primer
(F):5'- CCTAGACTATCCCAGGAAGGTG -3'
(R):5'- ACAGTCGAACGCATCCTGG -3'
Posted On2014-03-28