Incidental Mutation 'R1494:Ttll11'
ID163797
Institutional Source Beutler Lab
Gene Symbol Ttll11
Ensembl Gene ENSMUSG00000026885
Gene Nametubulin tyrosine ligase-like family, member 11
Synonyms4932702F08Rik, 4933424A20Rik, D2Ertd624e
MMRRC Submission 039545-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.214) question?
Stock #R1494 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location35751241-35979913 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 35795379 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 566 (T566P)
Ref Sequence ENSEMBL: ENSMUSP00000108600 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028248] [ENSMUST00000112976] [ENSMUST00000161970]
Predicted Effect probably damaging
Transcript: ENSMUST00000028248
AA Change: T599P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028248
Gene: ENSMUSG00000026885
AA Change: T599P

DomainStartEndE-ValueType
low complexity region 11 37 N/A INTRINSIC
low complexity region 79 101 N/A INTRINSIC
low complexity region 107 122 N/A INTRINSIC
Pfam:TTL 170 477 9.1e-68 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112976
AA Change: T566P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108600
Gene: ENSMUSG00000026885
AA Change: T566P

DomainStartEndE-ValueType
low complexity region 11 37 N/A INTRINSIC
low complexity region 79 101 N/A INTRINSIC
low complexity region 107 122 N/A INTRINSIC
Pfam:TTL 170 477 5.9e-68 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000160906
AA Change: T382P

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000125511
Gene: ENSMUSG00000026885
AA Change: T382P

DomainStartEndE-ValueType
Pfam:TTL 1 304 4.2e-65 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160939
Predicted Effect probably benign
Transcript: ENSMUST00000161970
SMART Domains Protein: ENSMUSP00000125627
Gene: ENSMUSG00000026885

DomainStartEndE-ValueType
SCOP:d1gosa1 33 88 5e-3 SMART
low complexity region 107 122 N/A INTRINSIC
Meta Mutation Damage Score 0.108 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.3%
Validation Efficiency 97% (57/59)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067P10Rik A G 17: 48,090,471 E92G probably benign Het
Abca13 C T 11: 9,466,429 Q4064* probably null Het
Abca14 G A 7: 120,216,301 M257I probably benign Het
Acsm2 T A 7: 119,575,632 C207S probably damaging Het
Actr3 A G 1: 125,416,281 I67T probably benign Het
Adcy7 T C 8: 88,320,207 V606A probably benign Het
Ahnak2 G A 12: 112,787,950 S54F probably damaging Het
Ano6 T C 15: 95,972,507 S848P probably damaging Het
Atg3 C T 16: 45,171,760 probably benign Het
Atp8b1 T A 18: 64,564,526 S416C probably damaging Het
C2cd5 A G 6: 143,041,346 probably benign Het
Capn11 A T 17: 45,643,809 V134E probably damaging Het
Ccnd3 A G 17: 47,598,108 probably null Het
Chaf1b T A 16: 93,888,110 V149E probably damaging Het
Col5a2 T A 1: 45,502,914 M1L unknown Het
Copa T C 1: 172,104,127 I315T probably benign Het
Cyp3a57 A G 5: 145,381,267 M353V probably damaging Het
Dcaf6 T C 1: 165,333,373 M828V probably damaging Het
Dock2 T A 11: 34,282,761 K1080* probably null Het
Dock6 A G 9: 21,814,742 V1424A probably benign Het
Foxa1 T C 12: 57,542,198 D412G probably damaging Het
Foxp4 G C 17: 47,880,353 probably benign Het
Galnt9 T A 5: 110,588,330 S171T probably damaging Het
Glt6d1 A G 2: 25,794,248 Y249H probably damaging Het
Gm37240 A T 3: 84,527,691 Y104N probably damaging Het
Gpx8 C T 13: 113,045,615 E95K possibly damaging Het
Grm1 T C 10: 10,689,706 T953A probably benign Het
Helz T C 11: 107,604,063 probably benign Het
Hif3a T C 7: 17,054,722 Y108C probably damaging Het
Kcnj13 A T 1: 87,389,217 L58Q probably damaging Het
Mfsd14b A T 13: 65,095,671 V53D probably damaging Het
Mrps7 G C 11: 115,604,126 probably benign Het
Mug1 G A 6: 121,879,300 G1013D probably damaging Het
Olfr652 T A 7: 104,564,831 Y203* probably null Het
Olfr767 A T 10: 129,079,615 M116K probably damaging Het
Pax6 T C 2: 105,691,610 I19T probably benign Het
Pde8b G A 13: 95,047,796 R416C probably damaging Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Pygl G A 12: 70,199,730 R348W probably damaging Het
Ralgapa1 T A 12: 55,684,524 D1874V probably damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Sncaip T C 18: 52,868,886 S160P probably damaging Het
Sptbn4 A G 7: 27,434,294 V79A probably damaging Het
Sptlc3 A T 2: 139,589,560 Y334F possibly damaging Het
Supt16 A G 14: 52,172,459 Y764H probably benign Het
Syne3 A T 12: 104,955,582 V438E possibly damaging Het
Tagap1 T C 17: 6,956,811 D162G probably damaging Het
Terb1 T C 8: 104,498,490 probably benign Het
Themis3 C A 17: 66,559,954 R97L probably benign Het
Tnk1 T A 11: 69,856,546 E86D possibly damaging Het
Tnpo3 A G 6: 29,557,044 L53P probably damaging Het
Trpc6 G A 9: 8,658,304 R725K probably benign Het
Unc5c A T 3: 141,827,549 T779S possibly damaging Het
Zfp42 A G 8: 43,295,601 C288R possibly damaging Het
Zfp763 G A 17: 33,021,503 T52I probably damaging Het
Other mutations in Ttll11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Ttll11 APN 2 35902720 nonsense probably null
IGL01148:Ttll11 APN 2 35784193 missense probably damaging 0.96
IGL02933:Ttll11 APN 2 35979410 missense probably benign
e-suppressor UTSW 2 35752406 missense probably damaging 1.00
R0356:Ttll11 UTSW 2 35902676 missense possibly damaging 0.66
R0494:Ttll11 UTSW 2 35944874 missense probably damaging 1.00
R1630:Ttll11 UTSW 2 35889325 missense probably damaging 0.96
R1688:Ttll11 UTSW 2 35795379 missense probably damaging 1.00
R1939:Ttll11 UTSW 2 35940753 missense probably null
R2414:Ttll11 UTSW 2 35979534 missense unknown
R2986:Ttll11 UTSW 2 35817738 missense probably benign 0.00
R4295:Ttll11 UTSW 2 35979552 small deletion probably benign
R4346:Ttll11 UTSW 2 35784118 missense probably benign 0.22
R5234:Ttll11 UTSW 2 35940733 missense probably damaging 1.00
R5340:Ttll11 UTSW 2 35902789 missense probably damaging 0.99
R5442:Ttll11 UTSW 2 35903123 makesense probably null
R5482:Ttll11 UTSW 2 35752406 missense probably damaging 1.00
R5604:Ttll11 UTSW 2 35817786 missense probably benign 0.07
R6219:Ttll11 UTSW 2 35752499 splice site probably null
R6481:Ttll11 UTSW 2 35902754 missense probably damaging 1.00
R6764:Ttll11 UTSW 2 35890448 intron probably null
R6944:Ttll11 UTSW 2 35752294 missense probably benign 0.05
X0026:Ttll11 UTSW 2 35795352 splice site probably null
Predicted Primers PCR Primer
(F):5'- GTGCCAGCCCTGAGATGAATACAG -3'
(R):5'- TGTACATCCCAAGGGAAGGAAGCC -3'

Sequencing Primer
(F):5'- TGAATACAGCCTCAAACAGGGTC -3'
(R):5'- ATCTGAACTGTGACCCGACTG -3'
Posted On2014-03-28