Incidental Mutation 'R1494:Ahnak2'
ID163834
Institutional Source Beutler Lab
Gene Symbol Ahnak2
Ensembl Gene ENSMUSG00000072812
Gene NameAHNAK nucleoprotein 2
SynonymsLOC382643
MMRRC Submission 039545-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R1494 (G1)
Quality Score161
Status Validated
Chromosome12
Chromosomal Location112772194-112802657 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 112787950 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 54 (S54F)
Ref Sequence ENSEMBL: ENSMUSP00000114522 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124526]
Predicted Effect probably damaging
Transcript: ENSMUST00000124526
AA Change: S54F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114522
Gene: ENSMUSG00000072812
AA Change: S54F

DomainStartEndE-ValueType
low complexity region 73 94 N/A INTRINSIC
PDZ 118 190 6e-4 SMART
low complexity region 268 281 N/A INTRINSIC
low complexity region 300 319 N/A INTRINSIC
low complexity region 405 429 N/A INTRINSIC
internal_repeat_1 465 898 2.74e-235 PROSPERO
low complexity region 905 923 N/A INTRINSIC
low complexity region 990 1013 N/A INTRINSIC
low complexity region 1076 1092 N/A INTRINSIC
internal_repeat_1 1145 1588 2.74e-235 PROSPERO
low complexity region 1590 1632 N/A INTRINSIC
low complexity region 1639 1700 N/A INTRINSIC
low complexity region 1709 1736 N/A INTRINSIC
Meta Mutation Damage Score 0.142 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.3%
Validation Efficiency 97% (57/59)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067P10Rik A G 17: 48,090,471 E92G probably benign Het
Abca13 C T 11: 9,466,429 Q4064* probably null Het
Abca14 G A 7: 120,216,301 M257I probably benign Het
Acsm2 T A 7: 119,575,632 C207S probably damaging Het
Actr3 A G 1: 125,416,281 I67T probably benign Het
Adcy7 T C 8: 88,320,207 V606A probably benign Het
Ano6 T C 15: 95,972,507 S848P probably damaging Het
Atg3 C T 16: 45,171,760 probably benign Het
Atp8b1 T A 18: 64,564,526 S416C probably damaging Het
C2cd5 A G 6: 143,041,346 probably benign Het
Capn11 A T 17: 45,643,809 V134E probably damaging Het
Ccnd3 A G 17: 47,598,108 probably null Het
Chaf1b T A 16: 93,888,110 V149E probably damaging Het
Col5a2 T A 1: 45,502,914 M1L unknown Het
Copa T C 1: 172,104,127 I315T probably benign Het
Cyp3a57 A G 5: 145,381,267 M353V probably damaging Het
Dcaf6 T C 1: 165,333,373 M828V probably damaging Het
Dock2 T A 11: 34,282,761 K1080* probably null Het
Dock6 A G 9: 21,814,742 V1424A probably benign Het
Foxa1 T C 12: 57,542,198 D412G probably damaging Het
Foxp4 G C 17: 47,880,353 probably benign Het
Galnt9 T A 5: 110,588,330 S171T probably damaging Het
Glt6d1 A G 2: 25,794,248 Y249H probably damaging Het
Gm37240 A T 3: 84,527,691 Y104N probably damaging Het
Gpx8 C T 13: 113,045,615 E95K possibly damaging Het
Grm1 T C 10: 10,689,706 T953A probably benign Het
Helz T C 11: 107,604,063 probably benign Het
Hif3a T C 7: 17,054,722 Y108C probably damaging Het
Kcnj13 A T 1: 87,389,217 L58Q probably damaging Het
Mfsd14b A T 13: 65,095,671 V53D probably damaging Het
Mrps7 G C 11: 115,604,126 probably benign Het
Mug1 G A 6: 121,879,300 G1013D probably damaging Het
Olfr652 T A 7: 104,564,831 Y203* probably null Het
Olfr767 A T 10: 129,079,615 M116K probably damaging Het
Pax6 T C 2: 105,691,610 I19T probably benign Het
Pde8b G A 13: 95,047,796 R416C probably damaging Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Pygl G A 12: 70,199,730 R348W probably damaging Het
Ralgapa1 T A 12: 55,684,524 D1874V probably damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Sncaip T C 18: 52,868,886 S160P probably damaging Het
Sptbn4 A G 7: 27,434,294 V79A probably damaging Het
Sptlc3 A T 2: 139,589,560 Y334F possibly damaging Het
Supt16 A G 14: 52,172,459 Y764H probably benign Het
Syne3 A T 12: 104,955,582 V438E possibly damaging Het
Tagap1 T C 17: 6,956,811 D162G probably damaging Het
Terb1 T C 8: 104,498,490 probably benign Het
Themis3 C A 17: 66,559,954 R97L probably benign Het
Tnk1 T A 11: 69,856,546 E86D possibly damaging Het
Tnpo3 A G 6: 29,557,044 L53P probably damaging Het
Trpc6 G A 9: 8,658,304 R725K probably benign Het
Ttll11 T G 2: 35,795,379 T566P probably damaging Het
Unc5c A T 3: 141,827,549 T779S possibly damaging Het
Zfp42 A G 8: 43,295,601 C288R possibly damaging Het
Zfp763 G A 17: 33,021,503 T52I probably damaging Het
Other mutations in Ahnak2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02257:Ahnak2 APN 12 112785285 missense possibly damaging 0.79
IGL02994:Ahnak2 APN 12 112786207 missense probably damaging 0.99
PIT4480001:Ahnak2 UTSW 12 112773924 missense possibly damaging 0.79
PIT4810001:Ahnak2 UTSW 12 112785594 missense
R0025:Ahnak2 UTSW 12 112785534 missense probably damaging 0.99
R0025:Ahnak2 UTSW 12 112785534 missense probably damaging 0.99
R0038:Ahnak2 UTSW 12 112774462 missense probably benign 0.00
R0125:Ahnak2 UTSW 12 112785156 missense probably benign 0.41
R1173:Ahnak2 UTSW 12 112785789 missense probably damaging 1.00
R1712:Ahnak2 UTSW 12 112785378 missense probably benign 0.05
R1888:Ahnak2 UTSW 12 112773891 missense possibly damaging 0.49
R1888:Ahnak2 UTSW 12 112773891 missense possibly damaging 0.49
R2042:Ahnak2 UTSW 12 112785819 missense probably damaging 0.98
R2056:Ahnak2 UTSW 12 112785006 missense probably benign 0.00
R2417:Ahnak2 UTSW 12 112775371 missense probably damaging 1.00
R2762:Ahnak2 UTSW 12 112785364 missense probably damaging 0.96
R3618:Ahnak2 UTSW 12 112786222 missense probably damaging 1.00
R3706:Ahnak2 UTSW 12 112773651 missense possibly damaging 0.74
R3739:Ahnak2 UTSW 12 112774558 missense probably benign 0.05
R3950:Ahnak2 UTSW 12 112785789 missense probably damaging 1.00
R4485:Ahnak2 UTSW 12 112779767 unclassified probably benign
R4651:Ahnak2 UTSW 12 112774837 missense possibly damaging 0.93
R4652:Ahnak2 UTSW 12 112774837 missense possibly damaging 0.93
R4831:Ahnak2 UTSW 12 112775749 missense probably damaging 0.99
R4836:Ahnak2 UTSW 12 112774116 missense probably damaging 1.00
R4837:Ahnak2 UTSW 12 112785739 missense probably benign 0.00
R4864:Ahnak2 UTSW 12 112773606 missense probably damaging 0.98
R4908:Ahnak2 UTSW 12 112775272 missense probably benign 0.00
R5067:Ahnak2 UTSW 12 112785316 missense probably benign 0.01
R5146:Ahnak2 UTSW 12 112775726 missense probably benign 0.00
R5228:Ahnak2 UTSW 12 112775386 missense probably benign 0.03
R5255:Ahnak2 UTSW 12 112773378 missense possibly damaging 0.92
R5323:Ahnak2 UTSW 12 112779812 unclassified probably benign
R5523:Ahnak2 UTSW 12 112775208 missense probably damaging 1.00
R5733:Ahnak2 UTSW 12 112775666 nonsense probably null
R5799:Ahnak2 UTSW 12 112778930 unclassified probably benign
R5817:Ahnak2 UTSW 12 112774003 missense probably damaging 1.00
R5835:Ahnak2 UTSW 12 112775796 missense possibly damaging 0.66
R6083:Ahnak2 UTSW 12 112782612 missense probably benign 0.06
R6083:Ahnak2 UTSW 12 112782999 missense probably benign 0.01
R6167:Ahnak2 UTSW 12 112783122 missense probably benign 0.03
R6168:Ahnak2 UTSW 12 112783122 missense probably benign 0.03
R6405:Ahnak2 UTSW 12 112773337 missense probably damaging 1.00
R6460:Ahnak2 UTSW 12 112786990 missense probably null 0.27
R6495:Ahnak2 UTSW 12 112773714 missense probably damaging 1.00
R6544:Ahnak2 UTSW 12 112780652 unclassified probably benign
R6656:Ahnak2 UTSW 12 112785371 missense probably benign 0.02
R6679:Ahnak2 UTSW 12 112772976 missense probably damaging 1.00
R6723:Ahnak2 UTSW 12 112778793 missense probably damaging 1.00
R6774:Ahnak2 UTSW 12 112773738 missense possibly damaging 0.87
R6884:Ahnak2 UTSW 12 112775429 missense possibly damaging 0.81
R6906:Ahnak2 UTSW 12 112785313 missense probably benign 0.00
R6919:Ahnak2 UTSW 12 112774684 missense possibly damaging 0.55
R7036:Ahnak2 UTSW 12 112778781 unclassified probably benign
R7037:Ahnak2 UTSW 12 112774278 missense probably damaging 0.99
R7064:Ahnak2 UTSW 12 112780742 unclassified probably benign
R7072:Ahnak2 UTSW 12 112788166 missense
R7112:Ahnak2 UTSW 12 112783119 missense
R7268:Ahnak2 UTSW 12 112780802 missense
R7269:Ahnak2 UTSW 12 112780802 missense
R7270:Ahnak2 UTSW 12 112780802 missense
R7271:Ahnak2 UTSW 12 112780802 missense
R7444:Ahnak2 UTSW 12 112781208 missense
R7448:Ahnak2 UTSW 12 112782502 missense
R7488:Ahnak2 UTSW 12 112785021 missense
Predicted Primers PCR Primer
(F):5'- GTTCCCACCTTAACAGTGGCTCAG -3'
(R):5'- GAGTGTTGCCCTTAGAGGAAACCC -3'

Sequencing Primer
(F):5'- TTAACAGTGGCTCAGCCAAC -3'
(R):5'- GAGGAAACCCATCCTCTTCAGTC -3'
Posted On2014-03-28