Incidental Mutation 'R1474:Rnf213'
ID163944
Institutional Source Beutler Lab
Gene Symbol Rnf213
Ensembl Gene ENSMUSG00000070327
Gene Namering finger protein 213
SynonymsD11Ertd759e
MMRRC Submission 039527-MU
Accession Numbers

Genbank: XM_001477846.2; Ensembl: ENSMUST00000131035, ENSMUST00000082107, ENSMUST00000093902, ENSMUST00000169768, ENSMUST00000172235

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1474 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location119393100-119487418 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 119437750 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 2002 (P2002L)
Ref Sequence ENSEMBL: ENSMUSP00000115063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093902] [ENSMUST00000131035]
Predicted Effect probably damaging
Transcript: ENSMUST00000093902
AA Change: P2003L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000091429
Gene: ENSMUSG00000070327
AA Change: P2003L

DomainStartEndE-ValueType
low complexity region 130 146 N/A INTRINSIC
low complexity region 265 279 N/A INTRINSIC
low complexity region 319 335 N/A INTRINSIC
low complexity region 676 688 N/A INTRINSIC
low complexity region 1114 1128 N/A INTRINSIC
low complexity region 1546 1558 N/A INTRINSIC
AAA 2373 2515 2.82e-2 SMART
AAA 2722 2890 3.63e-1 SMART
low complexity region 3449 3459 N/A INTRINSIC
RING 3947 3985 8.69e-5 SMART
Blast:PP2Ac 4544 4722 3e-66 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000131035
AA Change: P2002L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115063
Gene: ENSMUSG00000070327
AA Change: P2002L

DomainStartEndE-ValueType
low complexity region 130 146 N/A INTRINSIC
low complexity region 265 279 N/A INTRINSIC
low complexity region 319 335 N/A INTRINSIC
low complexity region 676 688 N/A INTRINSIC
low complexity region 1113 1127 N/A INTRINSIC
low complexity region 1545 1557 N/A INTRINSIC
AAA 2372 2514 2.82e-2 SMART
AAA 2721 2889 3.63e-1 SMART
low complexity region 3448 3458 N/A INTRINSIC
RING 3946 3984 8.69e-5 SMART
Blast:PP2Ac 4542 4720 3e-66 BLAST
Meta Mutation Damage Score 0.334 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 95% (104/110)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a C3HC4-type RING finger domain, which is a specialized type of Zn-finger that binds two atoms of zinc and is thought to be involved in mediating protein-protein interactions. The protein also contains an AAA domain, which is associated with ATPase activity. This gene is a susceptibility gene for Moyamoya disease, a vascular disorder of intracranial arteries. This gene is also a translocation partner in anaplastic large cell lymphoma and inflammatory myofibroblastic tumor cases, where a t(2;17)(p23;q25) translocation has been identified with the anaplastic lymphoma kinase (ALK) gene on chromosome 2, and a t(8;17)(q24;q25) translocation has been identified with the MYC gene on chromosome 8. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight and circulating glucose level but normal glucose tolerance, insulin sensitivity, insulin plasma levels and leptin plasma levels. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted, other(2) Gene trapped(11)

Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik C A 7: 139,976,642 R144L probably benign Het
9030624J02Rik T C 7: 118,760,213 F230S probably damaging Het
Abca8a C A 11: 110,069,809 A628S probably damaging Het
Abca9 T C 11: 110,145,579 N568S probably damaging Het
Ada C T 2: 163,732,894 A108T possibly damaging Het
Adam6a T A 12: 113,544,449 D147E possibly damaging Het
Ampd1 A T 3: 103,098,838 T655S probably damaging Het
Ankk1 A G 9: 49,415,839 F680S probably damaging Het
Asap1 G A 15: 64,120,020 T783I probably benign Het
Astn1 T A 1: 158,502,353 N259K probably damaging Het
Birc6 T C 17: 74,579,678 V667A probably damaging Het
Brat1 G A 5: 140,712,627 V185I probably benign Het
Btnl6 T C 17: 34,513,646 Y318C probably damaging Het
Caskin2 G A 11: 115,803,696 P360S probably benign Het
Cd68 T A 11: 69,664,928 probably benign Het
Cdca2 T C 14: 67,714,906 probably benign Het
Cdk6 G A 5: 3,473,217 M212I probably benign Het
Ceacam5 T A 7: 17,747,234 F302Y probably damaging Het
Celsr2 T C 3: 108,393,739 E2746G possibly damaging Het
Clec4a4 G A 6: 123,012,744 V115I probably benign Het
Clip3 C A 7: 30,298,882 A251E possibly damaging Het
Cmah T C 13: 24,439,197 L350P probably damaging Het
Cntnap5a C T 1: 116,442,373 R907* probably null Het
Cntnap5b T C 1: 100,072,089 Y191H probably benign Het
Col4a4 A T 1: 82,480,486 C1122* probably null Het
Coq5 A G 5: 115,295,783 probably benign Het
Cpxcr1 A G X: 116,477,439 K16E possibly damaging Het
Dclk3 T C 9: 111,469,236 I616T probably benign Het
Ddx58 A G 4: 40,208,868 V703A possibly damaging Het
Dhrs3 A T 4: 144,919,487 T122S probably damaging Het
Dnm1 T C 2: 32,320,584 I502V probably benign Het
Dscaml1 G T 9: 45,685,221 G788W probably damaging Het
Dusp10 C T 1: 184,037,448 probably null Het
Ehbp1l1 C A 19: 5,719,084 L730F possibly damaging Het
Eif2ak1 C T 5: 143,871,967 H75Y probably damaging Het
Evi2a T C 11: 79,527,572 T71A probably benign Het
Fam184a A T 10: 53,635,365 S1073T probably damaging Het
Fam227a T C 15: 79,615,381 Y591C probably damaging Het
Fam83a C T 15: 58,009,876 T367M probably benign Het
Fam83g A G 11: 61,702,993 D451G probably damaging Het
Fbn1 A G 2: 125,361,265 F1213L possibly damaging Het
Fcgbp G A 7: 28,091,848 V845I probably benign Het
Fermt1 C T 2: 132,925,022 E342K probably benign Het
Foxn1 T A 11: 78,361,107 M433L probably benign Het
Gm6583 T C 5: 112,355,776 T21A probably benign Het
Gm6632 T G 5: 59,054,336 noncoding transcript Het
Gnl3 A T 14: 31,016,461 probably benign Het
Hhipl1 C T 12: 108,311,737 T108I probably damaging Het
Hs2st1 A T 3: 144,435,495 F271I possibly damaging Het
Ido1 T C 8: 24,584,446 S303G probably damaging Het
Ints2 C T 11: 86,226,781 R705H probably damaging Het
Kcnc2 A G 10: 112,456,400 K49E probably damaging Het
Kif3b T A 2: 153,320,315 V482E probably damaging Het
Ldlrad2 G A 4: 137,572,214 P100S probably benign Het
Lrba G T 3: 86,780,266 probably benign Het
Lsm11 A T 11: 45,933,903 W266R probably benign Het
Mob3a A T 10: 80,687,154 M215K probably benign Het
Mterf1b T G 5: 4,197,163 L268R probably damaging Het
Mvk T C 5: 114,460,096 F365L probably damaging Het
Myo16 T A 8: 10,502,796 F945I probably damaging Het
Myo1f G T 17: 33,594,027 K602N possibly damaging Het
Nr2c2ap A T 8: 70,133,115 M108L probably benign Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Ogfrl1 A G 1: 23,375,809 F206L probably damaging Het
Ola1 A T 2: 73,156,844 I148N probably damaging Het
Olfr1158 A G 2: 87,990,990 N293S probably damaging Het
Olfr1424 T A 19: 12,059,480 T91S probably benign Het
Olfr310 G T 7: 86,269,062 H242Q probably damaging Het
Olfr583 A G 7: 103,052,081 Y261C probably damaging Het
Olfr791 A T 10: 129,526,955 M243L probably benign Het
Otof A G 5: 30,379,532 probably null Het
Pah G T 10: 87,578,313 K341N probably damaging Het
Pfdn5 T A 15: 102,328,511 probably null Het
Piezo2 A G 18: 63,083,131 C960R probably damaging Het
Pitx2 T C 3: 129,218,839 V306A probably damaging Het
Pkd1l2 C A 8: 117,065,497 probably benign Het
Plekho1 T C 3: 95,989,566 E197G probably damaging Het
Polr2i A G 7: 30,232,802 N34S probably damaging Het
Psph A T 5: 129,771,550 D22E probably damaging Het
Ptprs C A 17: 56,424,128 A687S probably damaging Het
Ralgapa1 T C 12: 55,741,480 K606R probably benign Het
Rims1 A G 1: 22,538,281 probably benign Het
Ryr3 A T 2: 112,909,962 C555S probably damaging Het
Sftpd C A 14: 41,172,427 G345V probably damaging Het
Slc41a1 T A 1: 131,846,581 M462K probably damaging Het
Slc44a2 A G 9: 21,353,694 E676G probably damaging Het
Sox6 T A 7: 115,701,691 probably benign Het
Spdye4b G A 5: 143,195,717 R109Q probably damaging Het
Spink8 A T 9: 109,820,638 I63L probably damaging Het
St3gal3 A G 4: 118,014,786 L73P probably damaging Het
Stab1 A G 14: 31,149,861 L1247P probably benign Het
Tat A G 8: 109,991,563 R27G probably benign Het
Tcerg1l C T 7: 138,280,075 R295H probably damaging Het
Tfrc T C 16: 32,626,649 V596A probably damaging Het
Tgfb3 C T 12: 86,069,346 probably null Het
Tmed5 A T 5: 108,132,382 S15T probably benign Het
Tph1 A T 7: 46,653,862 S231T probably benign Het
Trim30d G A 7: 104,472,494 S198L probably damaging Het
Trpm6 T C 19: 18,796,495 M412T probably benign Het
Ttn G T 2: 76,782,245 D15417E probably benign Het
U2surp A G 9: 95,493,198 I157T possibly damaging Het
Ubr4 A G 4: 139,429,579 D2305G probably damaging Het
Uvssa A G 5: 33,388,821 K179E probably benign Het
Xirp2 A G 2: 67,525,067 K3391E probably benign Het
Xpo7 T A 14: 70,699,033 H170L probably benign Het
Zrsr1 T C 11: 22,974,404 W393R probably benign Het
Other mutations in Rnf213
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Rnf213 APN 11 119449343 missense probably benign 0.00
IGL00961:Rnf213 APN 11 119440843 missense possibly damaging 0.55
IGL01324:Rnf213 APN 11 119447237 missense probably damaging 1.00
IGL01351:Rnf213 APN 11 119483118 missense probably benign 0.25
IGL01403:Rnf213 APN 11 119443300 missense probably damaging 1.00
IGL01704:Rnf213 APN 11 119449876 critical splice donor site probably null
IGL01765:Rnf213 APN 11 119436352 missense probably benign 0.00
IGL01803:Rnf213 APN 11 119441307 missense probably damaging 1.00
IGL01804:Rnf213 APN 11 119442266 missense probably damaging 1.00
IGL01900:Rnf213 APN 11 119443015 missense probably benign 0.05
IGL01944:Rnf213 APN 11 119416457 missense probably benign 0.01
IGL01982:Rnf213 APN 11 119443268 missense probably damaging 1.00
IGL02008:Rnf213 APN 11 119418309 splice site probably benign
IGL02084:Rnf213 APN 11 119445673 missense probably benign 0.04
IGL02253:Rnf213 APN 11 119440650 missense probably benign 0.03
IGL02254:Rnf213 APN 11 119480907 missense possibly damaging 0.89
IGL02296:Rnf213 APN 11 119463336 missense probably benign 0.01
IGL02531:Rnf213 APN 11 119436802 missense probably benign
IGL02588:Rnf213 APN 11 119416536 missense probably benign 0.30
IGL02615:Rnf213 APN 11 119440789 missense probably damaging 0.96
IGL02805:Rnf213 APN 11 119435066 missense probably damaging 0.99
IGL02887:Rnf213 APN 11 119427510 missense probably damaging 1.00
IGL03001:Rnf213 APN 11 119479941 missense probably damaging 1.00
IGL03035:Rnf213 APN 11 119445626 splice site probably benign
IGL03057:Rnf213 APN 11 119441087 missense probably damaging 1.00
IGL03148:Rnf213 APN 11 119465007 missense probably damaging 1.00
IGL03308:Rnf213 APN 11 119474172 missense probably benign 0.03
IGL03339:Rnf213 APN 11 119443004 missense probably damaging 1.00
IGL03369:Rnf213 APN 11 119421468 missense probably benign 0.34
attrition UTSW 11 119430321 missense possibly damaging 0.77
dinky UTSW 11 119416458 missense probably damaging 0.99
B6584:Rnf213 UTSW 11 119426069 missense probably damaging 0.97
PIT4585001:Rnf213 UTSW 11 119458392 missense
R0008:Rnf213 UTSW 11 119465052 missense possibly damaging 0.82
R0015:Rnf213 UTSW 11 119441606 missense possibly damaging 0.95
R0041:Rnf213 UTSW 11 119402575 missense probably benign 0.41
R0114:Rnf213 UTSW 11 119414587 missense probably damaging 1.00
R0131:Rnf213 UTSW 11 119430361 missense probably benign 0.10
R0131:Rnf213 UTSW 11 119430361 missense probably benign 0.10
R0132:Rnf213 UTSW 11 119430361 missense probably benign 0.10
R0138:Rnf213 UTSW 11 119416496 missense probably benign 0.05
R0144:Rnf213 UTSW 11 119479600 nonsense probably null
R0184:Rnf213 UTSW 11 119414521 missense probably damaging 0.99
R0321:Rnf213 UTSW 11 119438105 nonsense probably null
R0365:Rnf213 UTSW 11 119426111 missense possibly damaging 0.74
R0415:Rnf213 UTSW 11 119414469 missense probably damaging 1.00
R0421:Rnf213 UTSW 11 119447257 missense probably damaging 1.00
R0494:Rnf213 UTSW 11 119426012 missense possibly damaging 0.65
R0494:Rnf213 UTSW 11 119443120 missense probably damaging 1.00
R0549:Rnf213 UTSW 11 119465082 missense probably damaging 1.00
R0577:Rnf213 UTSW 11 119443280 missense probably damaging 1.00
R0605:Rnf213 UTSW 11 119431717 missense probably benign 0.03
R0638:Rnf213 UTSW 11 119470210 missense probably damaging 1.00
R0675:Rnf213 UTSW 11 119441834 missense probably benign 0.28
R0715:Rnf213 UTSW 11 119441150 missense probably damaging 0.97
R0732:Rnf213 UTSW 11 119441068 missense probably damaging 0.99
R0748:Rnf213 UTSW 11 119473480 missense probably damaging 1.00
R0765:Rnf213 UTSW 11 119423095 critical splice donor site probably null
R0890:Rnf213 UTSW 11 119430486 missense possibly damaging 0.94
R0927:Rnf213 UTSW 11 119414570 missense probably benign 0.00
R0940:Rnf213 UTSW 11 119416563 missense probably benign 0.10
R0959:Rnf213 UTSW 11 119452581 missense probably damaging 0.99
R1077:Rnf213 UTSW 11 119485998 splice site probably benign
R1104:Rnf213 UTSW 11 119477229 missense probably benign 0.29
R1141:Rnf213 UTSW 11 119435983 missense probably benign 0.02
R1219:Rnf213 UTSW 11 119436177 missense probably damaging 1.00
R1435:Rnf213 UTSW 11 119436005 missense probably damaging 1.00
R1444:Rnf213 UTSW 11 119442400 missense probably damaging 1.00
R1488:Rnf213 UTSW 11 119480889 missense probably benign 0.05
R1523:Rnf213 UTSW 11 119441888 missense probably damaging 1.00
R1548:Rnf213 UTSW 11 119442707 missense probably damaging 1.00
R1554:Rnf213 UTSW 11 119441839 missense probably benign 0.06
R1563:Rnf213 UTSW 11 119414526 missense probably benign 0.13
R1572:Rnf213 UTSW 11 119436611 missense probably damaging 1.00
R1585:Rnf213 UTSW 11 119463345 missense probably damaging 1.00
R1635:Rnf213 UTSW 11 119442579 missense probably damaging 0.97
R1663:Rnf213 UTSW 11 119437672 missense probably benign 0.01
R1789:Rnf213 UTSW 11 119440221 missense probably damaging 0.97
R1844:Rnf213 UTSW 11 119441183 missense probably damaging 1.00
R1871:Rnf213 UTSW 11 119450129 missense probably benign 0.08
R1893:Rnf213 UTSW 11 119416448 missense probably damaging 1.00
R1937:Rnf213 UTSW 11 119431685 missense probably damaging 1.00
R1967:Rnf213 UTSW 11 119480895 missense probably damaging 1.00
R1987:Rnf213 UTSW 11 119441107 missense probably damaging 1.00
R2000:Rnf213 UTSW 11 119436022 missense probably damaging 1.00
R2020:Rnf213 UTSW 11 119461918 missense probably damaging 0.99
R2100:Rnf213 UTSW 11 119467302 nonsense probably null
R2109:Rnf213 UTSW 11 119442663 nonsense probably null
R2115:Rnf213 UTSW 11 119428013 missense probably benign 0.00
R2126:Rnf213 UTSW 11 119450201 missense probably damaging 0.99
R2144:Rnf213 UTSW 11 119443690 missense probably damaging 0.99
R2145:Rnf213 UTSW 11 119415193 missense probably benign 0.03
R2168:Rnf213 UTSW 11 119415070 missense probably damaging 0.97
R2189:Rnf213 UTSW 11 119430361 missense probably benign 0.10
R2199:Rnf213 UTSW 11 119460009 missense probably benign 0.01
R2220:Rnf213 UTSW 11 119436428 missense possibly damaging 0.94
R2336:Rnf213 UTSW 11 119414604 missense probably benign 0.02
R2400:Rnf213 UTSW 11 119443195 missense probably damaging 1.00
R2679:Rnf213 UTSW 11 119459938 splice site probably null
R2698:Rnf213 UTSW 11 119410144 missense probably benign 0.26
R3151:Rnf213 UTSW 11 119468892 missense probably benign 0.03
R3607:Rnf213 UTSW 11 119441976 nonsense probably null
R3808:Rnf213 UTSW 11 119479558 missense probably damaging 1.00
R3854:Rnf213 UTSW 11 119480939 splice site probably benign
R3856:Rnf213 UTSW 11 119480939 splice site probably benign
R3973:Rnf213 UTSW 11 119469053 missense probably benign 0.27
R4014:Rnf213 UTSW 11 119445729 nonsense probably null
R4049:Rnf213 UTSW 11 119482448 missense possibly damaging 0.67
R4130:Rnf213 UTSW 11 119483006 missense probably damaging 1.00
R4153:Rnf213 UTSW 11 119409482 missense probably benign 0.27
R4167:Rnf213 UTSW 11 119441243 missense probably damaging 0.99
R4224:Rnf213 UTSW 11 119436823 nonsense probably null
R4332:Rnf213 UTSW 11 119436676 missense probably damaging 1.00
R4415:Rnf213 UTSW 11 119483964 missense probably damaging 0.99
R4547:Rnf213 UTSW 11 119479670 critical splice donor site probably null
R4609:Rnf213 UTSW 11 119437695 missense possibly damaging 0.86
R4684:Rnf213 UTSW 11 119441125 missense probably damaging 1.00
R4704:Rnf213 UTSW 11 119440349 missense probably damaging 1.00
R4719:Rnf213 UTSW 11 119420067 missense probably benign 0.38
R4751:Rnf213 UTSW 11 119445745 missense probably benign 0.12
R4828:Rnf213 UTSW 11 119416629 missense possibly damaging 0.61
R4837:Rnf213 UTSW 11 119442763 missense probably benign 0.00
R4894:Rnf213 UTSW 11 119481240 missense probably damaging 1.00
R4973:Rnf213 UTSW 11 119428157 missense possibly damaging 0.84
R5026:Rnf213 UTSW 11 119436764 missense probably damaging 1.00
R5034:Rnf213 UTSW 11 119410807 missense probably damaging 0.99
R5284:Rnf213 UTSW 11 119458866 missense possibly damaging 0.89
R5295:Rnf213 UTSW 11 119440816 missense probably benign 0.00
R5406:Rnf213 UTSW 11 119440808 missense probably damaging 1.00
R5441:Rnf213 UTSW 11 119409020 missense probably damaging 0.99
R5449:Rnf213 UTSW 11 119415076 missense probably benign 0.44
R5520:Rnf213 UTSW 11 119433499 missense probably damaging 1.00
R5636:Rnf213 UTSW 11 119436629 missense probably benign 0.04
R5636:Rnf213 UTSW 11 119436905 missense probably damaging 1.00
R5669:Rnf213 UTSW 11 119458785 missense possibly damaging 0.92
R5670:Rnf213 UTSW 11 119434686 critical splice acceptor site probably null
R5697:Rnf213 UTSW 11 119483894 missense possibly damaging 0.54
R5726:Rnf213 UTSW 11 119416458 missense probably damaging 0.99
R5808:Rnf213 UTSW 11 119436295 missense probably benign
R5861:Rnf213 UTSW 11 119473377 missense probably damaging 1.00
R5903:Rnf213 UTSW 11 119421369 missense probably damaging 0.98
R5949:Rnf213 UTSW 11 119443079 missense probably damaging 1.00
R6022:Rnf213 UTSW 11 119486010 missense probably benign 0.00
R6043:Rnf213 UTSW 11 119442101 missense probably damaging 0.97
R6089:Rnf213 UTSW 11 119416559 missense probably benign 0.14
R6123:Rnf213 UTSW 11 119411513 missense probably damaging 0.96
R6134:Rnf213 UTSW 11 119411470 missense probably damaging 0.99
R6135:Rnf213 UTSW 11 119442028 missense probably benign 0.02
R6146:Rnf213 UTSW 11 119435999 missense probably benign 0.41
R6163:Rnf213 UTSW 11 119458428 missense possibly damaging 0.86
R6272:Rnf213 UTSW 11 119414548 missense probably damaging 1.00
R6333:Rnf213 UTSW 11 119463366 missense probably damaging 1.00
R6370:Rnf213 UTSW 11 119477078 missense probably damaging 0.99
R6456:Rnf213 UTSW 11 119459966 missense probably benign 0.03
R6468:Rnf213 UTSW 11 119452687 missense possibly damaging 0.94
R6579:Rnf213 UTSW 11 119436280 missense probably damaging 0.96
R6648:Rnf213 UTSW 11 119479920 missense possibly damaging 0.81
R6727:Rnf213 UTSW 11 119430321 missense possibly damaging 0.77
R6739:Rnf213 UTSW 11 119442271 missense probably damaging 1.00
R6768:Rnf213 UTSW 11 119442236 missense probably damaging 0.99
R6817:Rnf213 UTSW 11 119462285 critical splice donor site probably null
R6820:Rnf213 UTSW 11 119448838 missense probably damaging 1.00
R6841:Rnf213 UTSW 11 119449866 missense probably benign 0.26
R6934:Rnf213 UTSW 11 119420067 missense probably benign 0.38
R7026:Rnf213 UTSW 11 119479655 missense possibly damaging 0.58
R7094:Rnf213 UTSW 11 119437604 splice site probably null
R7170:Rnf213 UTSW 11 119452575 missense
R7185:Rnf213 UTSW 11 119424198 missense
R7239:Rnf213 UTSW 11 119458788 missense
R7258:Rnf213 UTSW 11 119452575 missense
R7259:Rnf213 UTSW 11 119452575 missense
R7260:Rnf213 UTSW 11 119452575 missense
R7273:Rnf213 UTSW 11 119431756 splice site probably null
R7282:Rnf213 UTSW 11 119437992 missense
R7311:Rnf213 UTSW 11 119416547 missense
R7352:Rnf213 UTSW 11 119443579 missense
R7369:Rnf213 UTSW 11 119430468 missense
R7410:Rnf213 UTSW 11 119435051 missense
R7448:Rnf213 UTSW 11 119481291 missense
R7561:Rnf213 UTSW 11 119441719 missense
S24628:Rnf213 UTSW 11 119414469 missense probably damaging 1.00
X0021:Rnf213 UTSW 11 119441824 missense probably benign 0.14
X0062:Rnf213 UTSW 11 119473513 missense probably benign 0.05
X0064:Rnf213 UTSW 11 119440463 missense probably damaging 1.00
Z1088:Rnf213 UTSW 11 119477254 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- TGCGCCGTCAGTAGTCAGGAAAAG -3'
(R):5'- TACAGAGCTGCTTGTTTGCCCC -3'

Sequencing Primer
(F):5'- CTGGCTTGAATCAGAATCGC -3'
(R):5'- TTGCCCCTTGACAGGATG -3'
Posted On2014-03-28