Incidental Mutation 'R1474:Gnl3'
ID163951
Institutional Source Beutler Lab
Gene Symbol Gnl3
Ensembl Gene ENSMUSG00000042354
Gene Nameguanine nucleotide binding protein-like 3 (nucleolar)
Synonymsnucleostemin, NS
MMRRC Submission 039527-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1474 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location31012433-31019152 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 31016461 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153981 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022476] [ENSMUST00000037739] [ENSMUST00000052239] [ENSMUST00000112094] [ENSMUST00000112095] [ENSMUST00000112098] [ENSMUST00000112106] [ENSMUST00000144009] [ENSMUST00000146325] [ENSMUST00000168584] [ENSMUST00000226740] [ENSMUST00000227467] [ENSMUST00000228341]
Predicted Effect probably benign
Transcript: ENSMUST00000022476
SMART Domains Protein: ENSMUSP00000022476
Gene: ENSMUSG00000021916

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
Pfam:Glyco_transf_8 67 340 1.7e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000037739
SMART Domains Protein: ENSMUSP00000047119
Gene: ENSMUSG00000042354

DomainStartEndE-ValueType
Pfam:GN3L_Grn1 16 90 4.3e-25 PFAM
low complexity region 112 126 N/A INTRINSIC
SCOP:d1egaa1 130 207 3e-3 SMART
low complexity region 209 220 N/A INTRINSIC
Pfam:MMR_HSR1 251 362 2.3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000052239
SMART Domains Protein: ENSMUSP00000060476
Gene: ENSMUSG00000042323

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 516 627 6.07e-39 SMART
BROMO 651 765 3.01e-43 SMART
BROMO 775 881 2.53e-18 SMART
coiled coil region 907 934 N/A INTRINSIC
BAH 956 1049 8.64e-22 SMART
low complexity region 1058 1072 N/A INTRINSIC
BAH 1131 1247 3.02e-35 SMART
low complexity region 1293 1310 N/A INTRINSIC
HMG 1326 1396 2.87e-13 SMART
low complexity region 1405 1430 N/A INTRINSIC
low complexity region 1449 1477 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104024
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104609
Predicted Effect probably benign
Transcript: ENSMUST00000112094
SMART Domains Protein: ENSMUSP00000107723
Gene: ENSMUSG00000042323

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 322 338 N/A INTRINSIC
BROMO 347 457 1.57e-32 SMART
BROMO 484 595 6.07e-39 SMART
BROMO 619 733 3.01e-43 SMART
BROMO 743 849 2.53e-18 SMART
coiled coil region 875 902 N/A INTRINSIC
BAH 924 1042 1.33e-45 SMART
low complexity region 1051 1065 N/A INTRINSIC
BAH 1124 1240 3.02e-35 SMART
low complexity region 1286 1306 N/A INTRINSIC
HMG 1346 1416 2.87e-13 SMART
low complexity region 1425 1450 N/A INTRINSIC
low complexity region 1469 1497 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112095
SMART Domains Protein: ENSMUSP00000107724
Gene: ENSMUSG00000042323

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 516 627 6.07e-39 SMART
BROMO 651 765 3.01e-43 SMART
BROMO 775 881 2.53e-18 SMART
coiled coil region 907 934 N/A INTRINSIC
BAH 956 1074 1.33e-45 SMART
low complexity region 1083 1097 N/A INTRINSIC
BAH 1156 1272 3.02e-35 SMART
low complexity region 1318 1338 N/A INTRINSIC
HMG 1378 1448 2.87e-13 SMART
low complexity region 1457 1482 N/A INTRINSIC
low complexity region 1501 1529 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112098
SMART Domains Protein: ENSMUSP00000107727
Gene: ENSMUSG00000042323

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 531 642 6.07e-39 SMART
BROMO 666 780 3.01e-43 SMART
BROMO 790 896 2.53e-18 SMART
coiled coil region 922 949 N/A INTRINSIC
BAH 971 1089 1.33e-45 SMART
low complexity region 1098 1112 N/A INTRINSIC
BAH 1171 1287 3.02e-35 SMART
low complexity region 1333 1353 N/A INTRINSIC
HMG 1393 1463 1.62e-21 SMART
low complexity region 1479 1490 N/A INTRINSIC
low complexity region 1500 1515 N/A INTRINSIC
low complexity region 1527 1552 N/A INTRINSIC
low complexity region 1571 1599 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112106
SMART Domains Protein: ENSMUSP00000107734
Gene: ENSMUSG00000042323

DomainStartEndE-ValueType
Blast:BROMO 61 91 6e-16 BLAST
PDB:3IU5|A 61 91 6e-17 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000144009
SMART Domains Protein: ENSMUSP00000123518
Gene: ENSMUSG00000042323

DomainStartEndE-ValueType
Blast:BROMO 40 68 8e-14 BLAST
PDB:3IU5|A 64 84 8e-9 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145497
Predicted Effect probably benign
Transcript: ENSMUST00000146325
SMART Domains Protein: ENSMUSP00000122805
Gene: ENSMUSG00000042323

DomainStartEndE-ValueType
BROMO 64 174 4.97e-35 SMART
BROMO 196 310 5.84e-41 SMART
low complexity region 343 359 N/A INTRINSIC
BROMO 368 478 1.57e-32 SMART
BROMO 505 616 6.07e-39 SMART
BROMO 640 754 3.01e-43 SMART
BROMO 764 870 2.53e-18 SMART
coiled coil region 896 923 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157287
Predicted Effect probably benign
Transcript: ENSMUST00000168584
SMART Domains Protein: ENSMUSP00000129323
Gene: ENSMUSG00000021916

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
Pfam:Glyco_transf_8 67 340 8.6e-55 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226220
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226348
Predicted Effect probably benign
Transcript: ENSMUST00000226379
Predicted Effect probably benign
Transcript: ENSMUST00000226740
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226959
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227087
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227170
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227389
Predicted Effect probably benign
Transcript: ENSMUST00000227467
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227783
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227869
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228255
Predicted Effect probably benign
Transcript: ENSMUST00000228341
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228427
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228713
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228739
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228774
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 95% (104/110)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may interact with p53 and may be involved in tumorigenesis. The encoded protein also appears to be important for stem cell proliferation. This protein is found in both the nucleus and nucleolus. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous disruption of this gene leads to early embryonic loss as blastocysts fail to enter the S phase. MEFs heterozygous for a gene trap allele have reduced proliferative capacity while MEFs heterozygous for a null allele show reduced doubling rates,increased apoptosis and premature senescence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik C A 7: 139,976,642 R144L probably benign Het
9030624J02Rik T C 7: 118,760,213 F230S probably damaging Het
Abca8a C A 11: 110,069,809 A628S probably damaging Het
Abca9 T C 11: 110,145,579 N568S probably damaging Het
Ada C T 2: 163,732,894 A108T possibly damaging Het
Adam6a T A 12: 113,544,449 D147E possibly damaging Het
Ampd1 A T 3: 103,098,838 T655S probably damaging Het
Ankk1 A G 9: 49,415,839 F680S probably damaging Het
Asap1 G A 15: 64,120,020 T783I probably benign Het
Astn1 T A 1: 158,502,353 N259K probably damaging Het
Birc6 T C 17: 74,579,678 V667A probably damaging Het
Brat1 G A 5: 140,712,627 V185I probably benign Het
Btnl6 T C 17: 34,513,646 Y318C probably damaging Het
Caskin2 G A 11: 115,803,696 P360S probably benign Het
Cd68 T A 11: 69,664,928 probably benign Het
Cdca2 T C 14: 67,714,906 probably benign Het
Cdk6 G A 5: 3,473,217 M212I probably benign Het
Ceacam5 T A 7: 17,747,234 F302Y probably damaging Het
Celsr2 T C 3: 108,393,739 E2746G possibly damaging Het
Clec4a4 G A 6: 123,012,744 V115I probably benign Het
Clip3 C A 7: 30,298,882 A251E possibly damaging Het
Cmah T C 13: 24,439,197 L350P probably damaging Het
Cntnap5a C T 1: 116,442,373 R907* probably null Het
Cntnap5b T C 1: 100,072,089 Y191H probably benign Het
Col4a4 A T 1: 82,480,486 C1122* probably null Het
Coq5 A G 5: 115,295,783 probably benign Het
Cpxcr1 A G X: 116,477,439 K16E possibly damaging Het
Dclk3 T C 9: 111,469,236 I616T probably benign Het
Ddx58 A G 4: 40,208,868 V703A possibly damaging Het
Dhrs3 A T 4: 144,919,487 T122S probably damaging Het
Dnm1 T C 2: 32,320,584 I502V probably benign Het
Dscaml1 G T 9: 45,685,221 G788W probably damaging Het
Dusp10 C T 1: 184,037,448 probably null Het
Ehbp1l1 C A 19: 5,719,084 L730F possibly damaging Het
Eif2ak1 C T 5: 143,871,967 H75Y probably damaging Het
Evi2a T C 11: 79,527,572 T71A probably benign Het
Fam184a A T 10: 53,635,365 S1073T probably damaging Het
Fam227a T C 15: 79,615,381 Y591C probably damaging Het
Fam83a C T 15: 58,009,876 T367M probably benign Het
Fam83g A G 11: 61,702,993 D451G probably damaging Het
Fbn1 A G 2: 125,361,265 F1213L possibly damaging Het
Fcgbp G A 7: 28,091,848 V845I probably benign Het
Fermt1 C T 2: 132,925,022 E342K probably benign Het
Foxn1 T A 11: 78,361,107 M433L probably benign Het
Gm6583 T C 5: 112,355,776 T21A probably benign Het
Gm6632 T G 5: 59,054,336 noncoding transcript Het
Hhipl1 C T 12: 108,311,737 T108I probably damaging Het
Hs2st1 A T 3: 144,435,495 F271I possibly damaging Het
Ido1 T C 8: 24,584,446 S303G probably damaging Het
Ints2 C T 11: 86,226,781 R705H probably damaging Het
Kcnc2 A G 10: 112,456,400 K49E probably damaging Het
Kif3b T A 2: 153,320,315 V482E probably damaging Het
Ldlrad2 G A 4: 137,572,214 P100S probably benign Het
Lrba G T 3: 86,780,266 probably benign Het
Lsm11 A T 11: 45,933,903 W266R probably benign Het
Mob3a A T 10: 80,687,154 M215K probably benign Het
Mterf1b T G 5: 4,197,163 L268R probably damaging Het
Mvk T C 5: 114,460,096 F365L probably damaging Het
Myo16 T A 8: 10,502,796 F945I probably damaging Het
Myo1f G T 17: 33,594,027 K602N possibly damaging Het
Nr2c2ap A T 8: 70,133,115 M108L probably benign Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Ogfrl1 A G 1: 23,375,809 F206L probably damaging Het
Ola1 A T 2: 73,156,844 I148N probably damaging Het
Olfr1158 A G 2: 87,990,990 N293S probably damaging Het
Olfr1424 T A 19: 12,059,480 T91S probably benign Het
Olfr310 G T 7: 86,269,062 H242Q probably damaging Het
Olfr583 A G 7: 103,052,081 Y261C probably damaging Het
Olfr791 A T 10: 129,526,955 M243L probably benign Het
Otof A G 5: 30,379,532 probably null Het
Pah G T 10: 87,578,313 K341N probably damaging Het
Pfdn5 T A 15: 102,328,511 probably null Het
Piezo2 A G 18: 63,083,131 C960R probably damaging Het
Pitx2 T C 3: 129,218,839 V306A probably damaging Het
Pkd1l2 C A 8: 117,065,497 probably benign Het
Plekho1 T C 3: 95,989,566 E197G probably damaging Het
Polr2i A G 7: 30,232,802 N34S probably damaging Het
Psph A T 5: 129,771,550 D22E probably damaging Het
Ptprs C A 17: 56,424,128 A687S probably damaging Het
Ralgapa1 T C 12: 55,741,480 K606R probably benign Het
Rims1 A G 1: 22,538,281 probably benign Het
Rnf213 C T 11: 119,437,750 P2002L probably damaging Het
Ryr3 A T 2: 112,909,962 C555S probably damaging Het
Sftpd C A 14: 41,172,427 G345V probably damaging Het
Slc41a1 T A 1: 131,846,581 M462K probably damaging Het
Slc44a2 A G 9: 21,353,694 E676G probably damaging Het
Sox6 T A 7: 115,701,691 probably benign Het
Spdye4b G A 5: 143,195,717 R109Q probably damaging Het
Spink8 A T 9: 109,820,638 I63L probably damaging Het
St3gal3 A G 4: 118,014,786 L73P probably damaging Het
Stab1 A G 14: 31,149,861 L1247P probably benign Het
Tat A G 8: 109,991,563 R27G probably benign Het
Tcerg1l C T 7: 138,280,075 R295H probably damaging Het
Tfrc T C 16: 32,626,649 V596A probably damaging Het
Tgfb3 C T 12: 86,069,346 probably null Het
Tmed5 A T 5: 108,132,382 S15T probably benign Het
Tph1 A T 7: 46,653,862 S231T probably benign Het
Trim30d G A 7: 104,472,494 S198L probably damaging Het
Trpm6 T C 19: 18,796,495 M412T probably benign Het
Ttn G T 2: 76,782,245 D15417E probably benign Het
U2surp A G 9: 95,493,198 I157T possibly damaging Het
Ubr4 A G 4: 139,429,579 D2305G probably damaging Het
Uvssa A G 5: 33,388,821 K179E probably benign Het
Xirp2 A G 2: 67,525,067 K3391E probably benign Het
Xpo7 T A 14: 70,699,033 H170L probably benign Het
Zrsr1 T C 11: 22,974,404 W393R probably benign Het
Other mutations in Gnl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:Gnl3 APN 14 31014189 missense possibly damaging 0.71
IGL00826:Gnl3 APN 14 31012796 unclassified probably benign
IGL02323:Gnl3 APN 14 31017402 missense probably damaging 1.00
R0277:Gnl3 UTSW 14 31013427 critical splice donor site probably null
R0636:Gnl3 UTSW 14 31017153 missense probably damaging 1.00
R0727:Gnl3 UTSW 14 31017077 missense probably damaging 0.99
R1459:Gnl3 UTSW 14 31017846 missense probably damaging 1.00
R2016:Gnl3 UTSW 14 31016369 unclassified probably null
R2352:Gnl3 UTSW 14 31016826 critical splice donor site probably null
R2517:Gnl3 UTSW 14 31014163 missense probably damaging 1.00
R4115:Gnl3 UTSW 14 31016856 missense probably damaging 1.00
R4697:Gnl3 UTSW 14 31017329 missense probably damaging 0.98
R4853:Gnl3 UTSW 14 31015313 missense probably damaging 0.99
R4973:Gnl3 UTSW 14 31013505 missense possibly damaging 0.68
R5091:Gnl3 UTSW 14 31016846 missense possibly damaging 0.76
R5580:Gnl3 UTSW 14 31015285 missense probably benign
R5914:Gnl3 UTSW 14 31016896 missense possibly damaging 0.85
R6898:Gnl3 UTSW 14 31013179 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAATGGCAAACGCTCACATCAGTTC -3'
(R):5'- TCCCAATGTGCTTGCTTGCTAGAG -3'

Sequencing Primer
(F):5'- CAGTGGTAATCAGACTGTCCG -3'
(R):5'- CATGCATTTCCCAAGCTCAC -3'
Posted On2014-03-28